Rmu_sc0000368.1_g000036

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0000368.1
OG0023040
Physical Location & Seq
Reverse (-)
159685 .. 160056
372 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 372 bp
atgcccttaagggacgttttgggaacattcatgacactgctcccagaactggtcgttcagtggaatgaaatccacttgtttgactacaaaatggtcaatgacttcaacaaggacatgttgtgcttaaaagcacgtctcaatttctgtggaagggaaatcacagaagatgatgtgattgaaaagactctttccacttttcctacttcagcacttatactagcgaaccagtataggctggaatatgacaacaaaagaatcacaacattcaataagctgatcagcctactgcaagtggctaagagtcataatgaggttatcttgaacaacaatgccaggccaactgggacaaagaaaatttccgaggctaattaa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Retrotran_gag_2 zf-CCHC

Protein Analysis

123

Amino Acids

14.22

Weight (kDa)

6.72

Isoelectric Point (pI)

51.44

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0023040)

Species Orthologous Gene IDs
rosa_multiflora Rmu_sc0000368.1_g000036 Rmu_sc0002093.1_g000021 Rmu_sc0009583.1_g000007 Rmu_sc0023072.1_g000002

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 354
AcuI CTGAAG 1 cut(s) 189
AfiI CCNNNNNNNGG 1 cut(s) 49
AflII CTTAAG 1 cut(s) 7
AflIII ACRYGT 1 cut(s) 114
AgsI TTSAA 4 cut(s) 106, 179, 268, 322
AjiI CACGTC 1 cut(s) 134
AjnI CCWGG 1 cut(s) 332
AluBI AGCT 1 cut(s) 274
AluI AGCT 1 cut(s) 274
Alw26I GTCTC 1 cut(s) 140
AoxI GGCC 1 cut(s) 335
ApoI RAATTY 1 cut(s) 354
BciT130I CCWGG 1 cut(s) 334
BclI TGATCA 1 cut(s) 276
BcoDI GTCTC 1 cut(s) 140
BfaI CTAG 1 cut(s) 218
BfrI CTTAAG 1 cut(s) 7
Bme1390I CCNGG 1 cut(s) 334
BmgBI CACGTC 1 cut(s) 134
BmrFI CCNGG 1 cut(s) 334
BmrI ACTGGG 1 cut(s) 351
BmuI ACTGGG 1 cut(s) 351
BsaJI CCNNGG 1 cut(s) 360
Bsc4I CCNNNNNNNGG 1 cut(s) 49
Bse1I ACTGG 3 cut(s) 54, 226, 346
BseBI CCWGG 1 cut(s) 334
BseDI CCNNGG 1 cut(s) 360
BseLI CCNNNNNNNGG 1 cut(s) 49
BseNI ACTGG 3 cut(s) 54, 226, 346
BshFI GGCC 1 cut(s) 337
BslFI GGGAC 2 cut(s) 26, 358
BslI CCNNNNNNNGG 1 cut(s) 49
BsmAI GTCTC 1 cut(s) 140
BsmBI CGTCTC 1 cut(s) 140
BsmFI GGGAC 2 cut(s) 26, 358
BsnI GGCC 1 cut(s) 337
Bsp143I GATC 1 cut(s) 276
BspANI GGCC 1 cut(s) 337
BspHI TCATGA 1 cut(s) 30
BspTI CTTAAG 1 cut(s) 7
BsrI ACTGG 3 cut(s) 54, 226, 346
BssECI CCNNGG 1 cut(s) 360
BssMI GATC 1 cut(s) 276
Bst2UI CCWGG 1 cut(s) 334
BstAFI CTTAAG 1 cut(s) 7
BstDEI CTNAG 1 cut(s) 297
BstKTI GATC 1 cut(s) 279
BstMAI GTCTC 1 cut(s) 140
BstMBI GATC 1 cut(s) 276
BstNI CCWGG 1 cut(s) 334
BstNSI RCATGY 1 cut(s) 118
BstSCI CCNGG 1 cut(s) 332
BsuRI GGCC 1 cut(s) 337
BtrI CACGTC 1 cut(s) 134
BtsI GCAGTG 1 cut(s) 35
BtsIMutI CAGTG 2 cut(s) 35, 65
CciI TCATGA 1 cut(s) 30
CspCI CAANNNNNGTGG 2 cut(s) 127, 162
CviAII CATG 2 cut(s) 31, 115
CviJI RGCY 6 cut(s) 235, 274, 282, 296, 337, 365
CviKI_1 RGCY 6 cut(s) 235, 274, 282, 296, 337, 365
DdeI CTNAG 1 cut(s) 297
DpnI GATC 1 cut(s) 278
DpnII GATC 1 cut(s) 276
Eco57I CTGAAG 1 cut(s) 189
EcoRII CCWGG 1 cut(s) 332
Esp3I CGTCTC 1 cut(s) 140
FaeI CATG 2 cut(s) 34, 118
FaiI YATR 6 cut(s) 32, 116, 215, 231, 243, 306
FaqI GGGAC 2 cut(s) 26, 358
FatI CATG 2 cut(s) 30, 114
FbaI TGATCA 1 cut(s) 276
FspBI CTAG 1 cut(s) 218
HaeIII GGCC 1 cut(s) 337
Hin1II CATG 2 cut(s) 34, 118
HinfI GANTC 3 cut(s) 184, 255, 301
Hpy188I TCNGA 1 cut(s) 361
Hpy188III TCNNGA 2 cut(s) 31, 319
HpyAV CCTTC 1 cut(s) 144
HpyCH4IV ACGT 2 cut(s) 15, 133
HpyCH4V TGCA 1 cut(s) 289
HpyF3I CTNAG 1 cut(s) 297
HpySE526I ACGT 2 cut(s) 15, 133
Hsp92II CATG 2 cut(s) 34, 118
Ksp22I TGATCA 1 cut(s) 276
Kzo9I GATC 1 cut(s) 276
LmnI GCTCC 1 cut(s) 45
LpnPI CCDG 7 cut(s) 35, 57, 221, 239, 319, 327, 346
MaeI CTAG 1 cut(s) 218
MaeII ACGT 2 cut(s) 15, 133
MalI GATC 1 cut(s) 278
MboI GATC 1 cut(s) 276
MboII GAAGA 1 cut(s) 176
MluCI AATT 3 cut(s) 139, 354, 367
MlyI GAGTC 2 cut(s) 178, 310
MnlI CCTC 2 cut(s) 304, 355
MseI TTAA 3 cut(s) 8, 125, 370
MspCI CTTAAG 1 cut(s) 7
MspR9I CCNGG 1 cut(s) 334
MvaI CCWGG 1 cut(s) 334
NdeII GATC 1 cut(s) 276
NlaIII CATG 2 cut(s) 34, 118
NspI RCATGY 1 cut(s) 118
PagI TCATGA 1 cut(s) 30
PciI ACATGT 1 cut(s) 114
PfeI GAWTC 1 cut(s) 255
PleI GAGTC 2 cut(s) 178, 309
PpsI GAGTC 2 cut(s) 178, 309
PscI ACATGT 1 cut(s) 114
Psp6I CCWGG 1 cut(s) 332
PspGI CCWGG 1 cut(s) 332
SaqAI TTAA 3 cut(s) 8, 125, 370
Sau3AI GATC 1 cut(s) 276
SchI GAGTC 2 cut(s) 178, 310
ScrFI CCNGG 1 cut(s) 334
SetI ASST 4 cut(s) 18, 136, 276, 315
SmlI CTYRAG 1 cut(s) 7
SmoI CTYRAG 1 cut(s) 7
Sse9I AATT 3 cut(s) 139, 354, 367
SspMI CTAG 1 cut(s) 218
StyD4I CCNGG 1 cut(s) 332
TaiI ACGT 2 cut(s) 18, 136
TasI AATT 3 cut(s) 139, 354, 367
TfiI GAWTC 1 cut(s) 255
Tru1I TTAA 3 cut(s) 8, 125, 370
Tru9I TTAA 3 cut(s) 8, 125, 370
TscAI CASTG 2 cut(s) 42, 65
TspDTI ATGAA 2 cut(s) 19, 81
TspRI CASTG 2 cut(s) 42, 65
Vha464I CTTAAG 1 cut(s) 7
XapI RAATTY 1 cut(s) 354
XceI RCATGY 1 cut(s) 118
XspI CTAG 1 cut(s) 218
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.