Rmu_sc0002093.1_g000021

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0002093.1
OG0023040
Physical Location & Seq
Reverse (-)
80340 .. 82525
2186 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0002093.1_g000021.1.cds

Sequence Viewer

Length: 609 bp
atgttagttgtggtatcacgcgaccccagcctccaacctgcccagtcggatggcctgctgcacagatcccaccaccgccgccggacagccagatcgatcttccggatcgatcattcaacctccagcatctcactgcccccgcgtctacctgctgctgcactgagcaccgacacagcagcccatcccctcgcggcccctgcaaacccagcaacgcacgacaactccactgccaccattaccgaccccaaagatgatgaaccatctaatcagggacgttttgggaatattcatgacatttttctcccagaactggccgttcagtggaatggaatccgcttgcttgactacaaaagggtcaatgacttcaacaaagacatgttgcgccttaaggcacgtctcaatttctgtggaagggaaatcacagaagatgatatgatctacaagactcttaccacctttcctacttcagcatttattctagcgaaccagtataagttggagtatgacaacaaaataatcacaactttcaataagttaataagcctactacaagtggctgagagacataatgaggttctcttgaacaacaatgtcaggcccactccctag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Retrotran_gag_2 zf-CCHC

Protein Analysis

202

Amino Acids

22.82

Weight (kDa)

8.76

Isoelectric Point (pI)

52.56

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0023040)

Species Orthologous Gene IDs
rosa_multiflora Rmu_sc0000368.1_g000036 Rmu_sc0002093.1_g000021 Rmu_sc0009583.1_g000007 Rmu_sc0023072.1_g000002

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 2 cut(s) 46, 157
AccI GTMKAC 1 cut(s) 145
AccII CGCG 3 cut(s) 21, 142, 191
AccIII TCCGGA 1 cut(s) 102
AciI CCGC 5 cut(s) 76, 79, 140, 191, 334
AclWI GGATC 2 cut(s) 60, 113
AcoI YGGCCR 1 cut(s) 312
AcuI CTGAAG 1 cut(s) 450
AfiI CCNNNNNNNGG 2 cut(s) 310, 321
AflII CTTAAG 1 cut(s) 386
AflIII ACRYGT 1 cut(s) 375
AgsI TTSAA 4 cut(s) 117, 367, 529, 583
AjiI CACGTC 1 cut(s) 395
Alw21I GWGCWC 1 cut(s) 167
Alw26I GTCTC 2 cut(s) 401, 556
AlwI GGATC 2 cut(s) 60, 113
Aor13HI TCCGGA 1 cut(s) 102
AoxI GGCC 4 cut(s) 52, 192, 312, 596
ApeKI GCWGC 4 cut(s) 58, 152, 155, 176
AspLEI GCGC 1 cut(s) 384
AspS9I GGNCC 2 cut(s) 193, 597
Bbv12I GWGCWC 1 cut(s) 167
BbvI GCAGC 4 cut(s) 45, 139, 142, 188
BccI CCATC 3 cut(s) 44, 189, 268
BceAI ACGGC 1 cut(s) 299
BcoDI GTCTC 2 cut(s) 401, 556
BfaI CTAG 2 cut(s) 479, 607
BfrI CTTAAG 1 cut(s) 386
BfuAI ACCTGC 2 cut(s) 46, 157
BisI GCNGC 6 cut(s) 59, 79, 153, 156, 177, 192
BlsI GCNGC 6 cut(s) 60, 80, 154, 157, 178, 193
BmgBI CACGTC 1 cut(s) 395
BmgT120I GGNCC 2 cut(s) 193, 597
BmiI GGNNCC 1 cut(s) 195
BmrI ACTGGG 1 cut(s) 37
BmsI GCATC 1 cut(s) 135
BmuI ACTGGG 1 cut(s) 37
BpmI CTGGAG 1 cut(s) 106
Bsa29I ATCGAT 2 cut(s) 95, 108
BsaWI WCCGGW 1 cut(s) 102
BsaXI ACNNNNNCTCC 2 cut(s) 206, 236
Bsc4I CCNNNNNNNGG 2 cut(s) 310, 321
Bse1I ACTGG 3 cut(s) 43, 315, 487
BseAI TCCGGA 1 cut(s) 102
BseCI ATCGAT 2 cut(s) 95, 108
BseGI GGATG 2 cut(s) 55, 181
BseLI CCNNNNNNNGG 2 cut(s) 310, 321
BseMII CTCAG 2 cut(s) 152, 549
BseNI ACTGG 3 cut(s) 43, 315, 487
BseXI GCAGC 4 cut(s) 45, 139, 142, 188
BseYI CCCAGC 2 cut(s) 26, 205
BsgI GTGCAG 2 cut(s) 44, 141
Bsh1236I CGCG 3 cut(s) 21, 142, 191
BshFI GGCC 4 cut(s) 54, 194, 314, 598
BshVI ATCGAT 2 cut(s) 95, 108
BsiHKAI GWGCWC 1 cut(s) 167
BsiSI CCGG 2 cut(s) 82, 103
BslFI GGGAC 1 cut(s) 285
BslI CCNNNNNNNGG 2 cut(s) 310, 321
BsmAI GTCTC 2 cut(s) 401, 556
BsmBI CGTCTC 1 cut(s) 401
BsmFI GGGAC 1 cut(s) 285
BsnI GGCC 4 cut(s) 54, 194, 314, 598
Bsp1286I GDGCHC 1 cut(s) 167
Bsp13I TCCGGA 1 cut(s) 102
Bsp143I GATC 6 cut(s) 65, 92, 96, 105, 109, 435
BspACI CCGC 5 cut(s) 76, 79, 140, 191, 334
BspANI GGCC 4 cut(s) 54, 194, 314, 598
BspCNI CTCAG 2 cut(s) 153, 550
BspDI ATCGAT 2 cut(s) 95, 108
BspEI TCCGGA 1 cut(s) 102
BspFNI CGCG 3 cut(s) 21, 142, 191
BspHI TCATGA 1 cut(s) 289
BspLI GGNNCC 1 cut(s) 195
BspMI ACCTGC 2 cut(s) 46, 157
BspPI GGATC 2 cut(s) 60, 113
BspTI CTTAAG 1 cut(s) 386
BsrI ACTGG 3 cut(s) 43, 315, 487
BssMI GATC 6 cut(s) 65, 92, 96, 105, 109, 435
BstAFI CTTAAG 1 cut(s) 386
BstC8I GCNNGC 2 cut(s) 56, 338
BstDEI CTNAG 2 cut(s) 161, 558
BstF5I GGATG 2 cut(s) 55, 181
BstFNI CGCG 3 cut(s) 21, 142, 191
BstHHI GCGC 1 cut(s) 384
BstKTI GATC 6 cut(s) 68, 95, 99, 108, 112, 438
BstMAI GTCTC 2 cut(s) 401, 556
BstMBI GATC 6 cut(s) 65, 92, 96, 105, 109, 435
BstMWI GCNNNNNNNGC 3 cut(s) 27, 197, 206
BstNSI RCATGY 1 cut(s) 379
BstUI CGCG 3 cut(s) 21, 142, 191
BstV1I GCAGC 4 cut(s) 45, 139, 142, 188
BstX2I RGATCY 1 cut(s) 65
BstXI CCANNNNNNTGG 1 cut(s) 50
BstYI RGATCY 1 cut(s) 65
Bsu15I ATCGAT 2 cut(s) 95, 108
BsuRI GGCC 4 cut(s) 54, 194, 314, 598
BsuTUI ATCGAT 2 cut(s) 95, 108
BtrI CACGTC 1 cut(s) 395
BtsCI GGATG 2 cut(s) 55, 181
BtsI GCAGTG 2 cut(s) 131, 225
BtsIMutI CAGTG 4 cut(s) 131, 158, 225, 326
BveI ACCTGC 2 cut(s) 46, 157
Cac8I GCNNGC 2 cut(s) 56, 338
CciI TCATGA 1 cut(s) 289
CfoI GCGC 1 cut(s) 384
Cfr13I GGNCC 2 cut(s) 193, 597
ClaI ATCGAT 2 cut(s) 95, 108
CseI GACGC 1 cut(s) 131
CspCI CAANNNNNGTGG 2 cut(s) 388, 423
CviAII CATG 2 cut(s) 290, 376
CviJI RGCY 9 cut(s) 30, 54, 89, 179, 194, 314, 543, 557, 598
CviKI_1 RGCY 9 cut(s) 30, 54, 89, 179, 194, 314, 543, 557, 598
DdeI CTNAG 2 cut(s) 161, 558
DpnI GATC 6 cut(s) 67, 94, 98, 107, 111, 437
DpnII GATC 6 cut(s) 65, 92, 96, 105, 109, 435
EaeI YGGCCR 1 cut(s) 312
Eco57I CTGAAG 1 cut(s) 450
Esp3I CGTCTC 1 cut(s) 401
FaeI CATG 2 cut(s) 293, 379
FaiI YATR 6 cut(s) 291, 377, 434, 492, 504, 567
FaqI GGGAC 1 cut(s) 285
FatI CATG 2 cut(s) 289, 375
FauI CCCGC 1 cut(s) 147
FblI GTMKAC 1 cut(s) 145
Fnu4HI GCNGC 6 cut(s) 59, 79, 153, 156, 177, 192
FokI GGATG 2 cut(s) 62, 168
Fsp4HI GCNGC 6 cut(s) 59, 79, 153, 156, 177, 192
FspBI CTAG 2 cut(s) 479, 607
GlaI GCGC 1 cut(s) 383
GluI GCNGC 6 cut(s) 59, 79, 153, 156, 177, 192
GsaI CCCAGC 2 cut(s) 30, 209
GsuI CTGGAG 1 cut(s) 106
HaeIII GGCC 4 cut(s) 54, 194, 314, 598
HapII CCGG 2 cut(s) 82, 103
HgaI GACGC 1 cut(s) 131
HhaI GCGC 1 cut(s) 384
Hin1II CATG 2 cut(s) 293, 379
Hin6I GCGC 1 cut(s) 382
HinP1I GCGC 1 cut(s) 382
HinfI GANTC 2 cut(s) 330, 445
HpaII CCGG 2 cut(s) 82, 103
Hpy166II GTNNAC 1 cut(s) 146
Hpy188I TCNGA 1 cut(s) 49
Hpy188III TCNNGA 3 cut(s) 103, 290, 580
Hpy8I GTNNAC 1 cut(s) 146
HpyAV CCTTC 1 cut(s) 405
HpyCH4IV ACGT 2 cut(s) 274, 394
HpyCH4V TGCA 3 cut(s) 61, 158, 200
HpyF10VI GCNNNNNNNGC 3 cut(s) 27, 197, 206
HpyF3I CTNAG 2 cut(s) 161, 558
HpySE526I ACGT 2 cut(s) 274, 394
Hsp92II CATG 2 cut(s) 293, 379
HspAI GCGC 1 cut(s) 382
Kpn2I TCCGGA 1 cut(s) 102
Kzo9I GATC 6 cut(s) 65, 92, 96, 105, 109, 435
Lsp1109I GCAGC 4 cut(s) 45, 139, 142, 188
LweI GCATC 1 cut(s) 135
MaeI CTAG 2 cut(s) 479, 607
MaeII ACGT 2 cut(s) 274, 394
MalI GATC 6 cut(s) 67, 94, 98, 107, 111, 437
MboI GATC 6 cut(s) 65, 92, 96, 105, 109, 435
MboII GAAGA 2 cut(s) 91, 437
MflI RGATCY 1 cut(s) 65
MhlI GDGCHC 1 cut(s) 167
MluCI AATT 1 cut(s) 400
MlyI GAGTC 1 cut(s) 439
MmeI TCCRAC 3 cut(s) 27, 58, 477
MnlI CCTC 4 cut(s) 41, 130, 197, 565
MroI TCCGGA 1 cut(s) 102
MseI TTAA 2 cut(s) 387, 536
MspCI CTTAAG 1 cut(s) 386
MspI CCGG 2 cut(s) 82, 103
MvnI CGCG 3 cut(s) 21, 142, 191
MwoI GCNNNNNNNGC 3 cut(s) 27, 197, 206
NdeII GATC 6 cut(s) 65, 92, 96, 105, 109, 435
NlaIII CATG 2 cut(s) 293, 379
NlaIV GGNNCC 1 cut(s) 195
NspI RCATGY 1 cut(s) 379
PagI TCATGA 1 cut(s) 289
PciI ACATGT 1 cut(s) 375
PfeI GAWTC 1 cut(s) 330
PkrI GCNGC 6 cut(s) 60, 80, 154, 157, 178, 193
PleI GAGTC 1 cut(s) 439
PpsI GAGTC 1 cut(s) 439
PscI ACATGT 1 cut(s) 375
PspFI CCCAGC 2 cut(s) 26, 205
PspN4I GGNNCC 1 cut(s) 195
PspPI GGNCC 2 cut(s) 193, 597
PsuI RGATCY 1 cut(s) 65
SaqAI TTAA 2 cut(s) 387, 536
SatI GCNGC 6 cut(s) 59, 79, 153, 156, 177, 192
Sau3AI GATC 6 cut(s) 65, 92, 96, 105, 109, 435
Sau96I GGNCC 2 cut(s) 193, 597
SchI GAGTC 1 cut(s) 439
SduI GDGCHC 1 cut(s) 167
SetI ASST 7 cut(s) 40, 122, 151, 277, 397, 458, 576
SfaNI GCATC 1 cut(s) 135
SmlI CTYRAG 1 cut(s) 386
SmoI CTYRAG 1 cut(s) 386
Sse9I AATT 1 cut(s) 400
SsiI CCGC 5 cut(s) 76, 79, 140, 191, 334
SspI AATATT 1 cut(s) 286
SspMI CTAG 2 cut(s) 479, 607
TaiI ACGT 2 cut(s) 277, 397
TaqI TCGA 2 cut(s) 95, 108
TasI AATT 1 cut(s) 400
TauI GCSGC 2 cut(s) 81, 194
TfiI GAWTC 1 cut(s) 330
Tru1I TTAA 2 cut(s) 387, 536
Tru9I TTAA 2 cut(s) 387, 536
TscAI CASTG 4 cut(s) 138, 165, 232, 326
TseI GCWGC 4 cut(s) 58, 152, 155, 176
TspDTI ATGAA 2 cut(s) 270, 278
TspRI CASTG 4 cut(s) 138, 165, 232, 326
Vha464I CTTAAG 1 cut(s) 386
XceI RCATGY 1 cut(s) 379
XmiI GTMKAC 1 cut(s) 145
XspI CTAG 2 cut(s) 479, 607
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.