Rmu_sc0000394.1_g000044

Domain of unknown function (DUF3444)

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0000394.1
OG0031069
Physical Location & Seq
Forward (+)
160177 .. 160908
732 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 732 bp
atgttcacaagtaatgatagctccctacatgcaacacagaatatactaaaagagaagactaggaagaaaatgagtgaacggggatcatctagtgtagccaaaactgcagtaaacaaggcagagaatggaaatgagagaggaaattcttcaagaaactctgatatgcagtgtgatcgcaacatgtccagcattggcaagttggtggatacaaagaataccattctcacaagtaatgatatctctctacatgcaacacagaatatactaaaagagaagactaggaagaaaatgagtgaacggggatcatctagtgtagccaaaactgcagtaaacaaggcacataatggaaatgagagaggaaaatcttcaagaaactctgatatgcagtgtgatcgcaacatgtccggcattggcaagctggtggatacaaagaacattggtacatgtgacttgaaacagtctggcactagtggtgtcagctcagattcgggtgcagaaatcttggaagcaatgacgtcaattgatgttcctgatcctgattttcacaattttgatgaggatcgaacagaaaagtctttttttaaaaatcaggtctgggccgcctatgatgaggttaatgggatgcctcggtattatgccaaaattcagagtgtaagttctttagatcctttcacaatgcggatcagttggcttgattcaaaaaccaatagagaactggggcctctaaactga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
DUF3444 DnaJ

Protein Analysis

243

Amino Acids

26.85

Weight (kDa)

9.03

Isoelectric Point (pI)

44.2

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
DUF3444 PF11926 172 - 237 5.5e-23 Domain of unknown function (DUF3444)
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0031069)

Species Orthologous Gene IDs
rosa_multiflora Rmu_sc0000394.1_g000044
rosa_wichuraiana Rw7G023310

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AatII GACGTC 1 cut(s) 518
AciI CCGC 2 cut(s) 600, 679
AclWI GGATC 6 cut(s) 91, 310, 527, 567, 659, 689
AcsI RAATTY 2 cut(s) 142, 642
AcyI GRCGYC 1 cut(s) 515
AfaI GTAC 1 cut(s) 442
AflIII ACRYGT 3 cut(s) 180, 399, 443
AgsI TTSAA 4 cut(s) 150, 369, 454, 699
AhlI ACTAGT 1 cut(s) 467
AluBI AGCT 3 cut(s) 21, 418, 480
AluI AGCT 3 cut(s) 21, 418, 480
AlwI GGATC 6 cut(s) 91, 310, 527, 567, 659, 689
AoxI GGCC 2 cut(s) 597, 719
ApoI RAATTY 2 cut(s) 142, 642
Asp700I GAANNNNTTC 2 cut(s) 145, 364
AspS9I GGNCC 2 cut(s) 597, 719
BbsI GAAGAC 2 cut(s) 62, 281
BcgI CGANNNNNNTGC 4 cut(s) 155, 189, 374, 408
BciVI GTATCC 2 cut(s) 199, 418
BcuI ACTAGT 1 cut(s) 467
BfaI CTAG 5 cut(s) 60, 90, 279, 309, 468
BfmI CTRYAG 2 cut(s) 105, 324
BfuI GTATCC 2 cut(s) 199, 418
BisI GCNGC 1 cut(s) 600
BlsI GCNGC 1 cut(s) 601
BmgT120I GGNCC 2 cut(s) 597, 719
BmiI GGNNCC 1 cut(s) 720
BmrI ACTGGG 1 cut(s) 725
BmsI GCATC 1 cut(s) 612
BmuI ACTGGG 1 cut(s) 725
BpiI GAAGAC 2 cut(s) 62, 281
BsaBI GATNNNNATC 1 cut(s) 558
BsaHI GRCGYC 1 cut(s) 515
BsaJI CCNNGG 1 cut(s) 626
Bse1I ACTGG 1 cut(s) 720
Bse3DI GCAATG 1 cut(s) 516
Bse8I GATNNNNATC 1 cut(s) 558
BseDI CCNNGG 1 cut(s) 626
BseGI GGATG 1 cut(s) 627
BseJI GATNNNNATC 1 cut(s) 558
BseMI GCAATG 1 cut(s) 516
BseMII CTCAG 1 cut(s) 495
BseNI ACTGG 1 cut(s) 720
BsgI GTGCAG 1 cut(s) 513
BshFI GGCC 2 cut(s) 599, 721
BsiSI CCGG 1 cut(s) 405
BsnI GGCC 2 cut(s) 599, 721
Bsp143I GATC 8 cut(s) 83, 172, 302, 391, 532, 559, 664, 681
BspACI CCGC 2 cut(s) 600, 679
BspANI GGCC 2 cut(s) 599, 721
BspCNI CTCAG 1 cut(s) 494
BspLI GGNNCC 1 cut(s) 720
BspMAI CTGCAG 2 cut(s) 109, 328
BspPI GGATC 6 cut(s) 91, 310, 527, 567, 659, 689
BsrDI GCAATG 1 cut(s) 516
BsrI ACTGG 1 cut(s) 720
BssECI CCNNGG 1 cut(s) 626
BssMI GATC 8 cut(s) 83, 172, 302, 391, 532, 559, 664, 681
BssNI GRCGYC 1 cut(s) 515
Bst4CI ACNGT 1 cut(s) 459
BstACI GRCGYC 1 cut(s) 515
BstC8I GCNNGC 1 cut(s) 416
BstDEI CTNAG 1 cut(s) 481
BstF5I GGATG 1 cut(s) 627
BstKTI GATC 8 cut(s) 86, 175, 305, 394, 535, 562, 667, 684
BstMBI GATC 8 cut(s) 83, 172, 302, 391, 532, 559, 664, 681
BstMWI GCNNNNNNNGC 2 cut(s) 104, 323
BstNSI RCATGY 5 cut(s) 32, 184, 251, 403, 447
BstSFI CTRYAG 2 cut(s) 105, 324
BstV2I GAAGAC 2 cut(s) 62, 281
BstX2I RGATCY 1 cut(s) 664
BstYI RGATCY 1 cut(s) 664
BsuI GTATCC 2 cut(s) 199, 418
BsuRI GGCC 2 cut(s) 599, 721
BtsCI GGATG 1 cut(s) 627
BtsI GCAGTG 2 cut(s) 173, 392
BtsIMutI CAGTG 2 cut(s) 173, 392
Cac8I GCNNGC 1 cut(s) 416
Cfr13I GGNCC 2 cut(s) 597, 719
Csp6I GTAC 1 cut(s) 441
CviAII CATG 5 cut(s) 29, 181, 248, 400, 444
CviJI RGCY 8 cut(s) 21, 98, 317, 418, 480, 599, 691, 721
CviKI_1 RGCY 8 cut(s) 21, 98, 317, 418, 480, 599, 691, 721
CviQI GTAC 1 cut(s) 441
DdeI CTNAG 1 cut(s) 481
DpnI GATC 8 cut(s) 85, 174, 304, 393, 534, 561, 666, 683
DpnII GATC 8 cut(s) 83, 172, 302, 391, 532, 559, 664, 681
DraI TTTAAA 1 cut(s) 583
Eco32I GATATC 1 cut(s) 238
EcoO109I RGGNCCY 1 cut(s) 719
EcoRV GATATC 1 cut(s) 238
FaeI CATG 5 cut(s) 32, 184, 251, 403, 447
FatI CATG 5 cut(s) 28, 180, 247, 399, 443
Fnu4HI GCNGC 1 cut(s) 600
FokI GGATG 1 cut(s) 634
Fsp4HI GCNGC 1 cut(s) 600
FspBI CTAG 5 cut(s) 60, 90, 279, 309, 468
GluI GCNGC 1 cut(s) 600
HaeIII GGCC 2 cut(s) 599, 721
HapII CCGG 1 cut(s) 405
Hin1I GRCGYC 1 cut(s) 515
Hin1II CATG 5 cut(s) 32, 184, 251, 403, 447
HinfI GANTC 2 cut(s) 485, 695
HpaII CCGG 1 cut(s) 405
Hpy166II GTNNAC 5 cut(s) 6, 77, 112, 296, 331
Hpy188I TCNGA 4 cut(s) 160, 379, 484, 648
Hpy188III TCNNGA 4 cut(s) 150, 369, 530, 536
Hpy8I GTNNAC 5 cut(s) 6, 77, 112, 296, 331
HpyCH4III ACNGT 1 cut(s) 459
HpyCH4IV ACGT 1 cut(s) 515
HpyCH4V TGCA 7 cut(s) 32, 107, 166, 251, 326, 385, 494
HpyF10VI GCNNNNNNNGC 2 cut(s) 104, 323
HpyF3I CTNAG 1 cut(s) 481
HpySE526I ACGT 1 cut(s) 515
Hsp92I GRCGYC 1 cut(s) 515
Hsp92II CATG 5 cut(s) 32, 184, 251, 403, 447
Kzo9I GATC 8 cut(s) 83, 172, 302, 391, 532, 559, 664, 681
LmnI GCTCC 1 cut(s) 26
LpnPI CCDG 9 cut(s) 199, 404, 418, 447, 543, 549, 575, 580, 701
LweI GCATC 1 cut(s) 612
MaeI CTAG 5 cut(s) 60, 90, 279, 309, 468
MaeII ACGT 1 cut(s) 515
MaeIII GTNAC 1 cut(s) 446
MalI GATC 8 cut(s) 85, 174, 304, 393, 534, 561, 666, 683
MboI GATC 8 cut(s) 83, 172, 302, 391, 532, 559, 664, 681
MboII GAAGA 6 cut(s) 67, 76, 138, 286, 295, 357
MfeI CAATTG 1 cut(s) 519
MflI RGATCY 1 cut(s) 664
MluCI AATT 4 cut(s) 142, 519, 547, 642
MnlI CCTC 6 cut(s) 131, 350, 550, 604, 636, 732
MroXI GAANNNNTTC 2 cut(s) 145, 364
MseI TTAA 2 cut(s) 582, 615
MspI CCGG 1 cut(s) 405
MunI CAATTG 1 cut(s) 519
MwoI GCNNNNNNNGC 2 cut(s) 104, 323
NdeII GATC 8 cut(s) 83, 172, 302, 391, 532, 559, 664, 681
NlaIII CATG 5 cut(s) 32, 184, 251, 403, 447
NlaIV GGNNCC 1 cut(s) 720
NmuCI GTSAC 1 cut(s) 446
NspI RCATGY 5 cut(s) 32, 184, 251, 403, 447
PciI ACATGT 3 cut(s) 180, 399, 443
PdmI GAANNNNTTC 2 cut(s) 145, 364
PfeI GAWTC 2 cut(s) 485, 695
PkrI GCNGC 1 cut(s) 601
PscI ACATGT 3 cut(s) 180, 399, 443
PspN4I GGNNCC 1 cut(s) 720
PspPI GGNCC 2 cut(s) 597, 719
PstI CTGCAG 2 cut(s) 109, 328
PsuI RGATCY 1 cut(s) 664
RsaI GTAC 1 cut(s) 442
RsaNI GTAC 1 cut(s) 441
SaqAI TTAA 2 cut(s) 582, 615
SatI GCNGC 1 cut(s) 600
Sau3AI GATC 8 cut(s) 83, 172, 302, 391, 532, 559, 664, 681
Sau96I GGNCC 2 cut(s) 597, 719
SetI ASST 6 cut(s) 23, 420, 482, 518, 594, 615
SfaNI GCATC 1 cut(s) 612
SfcI CTRYAG 2 cut(s) 105, 324
SpeI ACTAGT 1 cut(s) 467
Sse9I AATT 4 cut(s) 142, 519, 547, 642
SsiI CCGC 2 cut(s) 600, 679
SspMI CTAG 5 cut(s) 60, 90, 279, 309, 468
TaaI ACNGT 1 cut(s) 459
TaiI ACGT 1 cut(s) 518
TaqI TCGA 1 cut(s) 562
TasI AATT 4 cut(s) 142, 519, 547, 642
TauI GCSGC 1 cut(s) 602
TfiI GAWTC 2 cut(s) 485, 695
Tru1I TTAA 2 cut(s) 582, 615
Tru9I TTAA 2 cut(s) 582, 615
TscAI CASTG 2 cut(s) 173, 392
TseFI GTSAC 1 cut(s) 446
Tsp45I GTSAC 1 cut(s) 446
TspRI CASTG 2 cut(s) 173, 392
XapI RAATTY 2 cut(s) 142, 642
XceI RCATGY 5 cut(s) 32, 184, 251, 403, 447
XcmI CCANNNNNNNNNTGG 1 cut(s) 712
XmnI GAANNNNTTC 2 cut(s) 145, 364
XspI CTAG 5 cut(s) 60, 90, 279, 309, 468
ZraI GACGTC 1 cut(s) 516
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.