Rmu_sc0000524.1_g000029

Protein of unknown function (DUF1005)

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0000524.1
OG0014428
Physical Location & Seq
Forward (+)
144917 .. 147414
2498 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0000524.1_g000029.1.cds

Sequence Viewer

Length: 1266 bp
atggatccgtgtccctttgttcgggtcatggtcgactctttagccctgaagcttccacacgccaccaagcctgcaggttccggagttcactcctccaccactccctgtttctgcgagctgaggatcaagaactttcctccccaaactgcccttctcagtctctccagctctactaacgactcccctcccgactcgtttacctcagcgcatgggttcaacctggacccgactgcgctgaggctgttgtcgggaaagcccatcacgctccgtgtgtctgtatacacggggcggatgggcaggacatgtggagtcaccagcgggaagttgctgggccgggtcaacctcagcattgatctcgacgcggccaagtccagcccgcgagtgatccacaacgggtggatgaagctcgggagtcatagcgacaagccctcctccgccaggctgcacatgacggtccgggctgaaccggatccccggtttgtttttcagttcggtggcgaaccggagtgtagtccggtggtttttcagattcaggggcgggatatacgccagcctgtttttagctgcaagttcagtgccgaccgtaattccagattccgatctctgccaccagatttcaccagcaagaataatagaggatggaggagaaccttttcaggtgaaagagaaaggcctggaagggaaagaaagggttggatgataacaattcatgatctatccggctcacctgtggcggctgcctccatgatcacaccctttgtaccgtccccggggtccgaccgggtctctaggtcaaacccgggtgcttggctaatcctcagaccacatggcttttctgtgaacaactggaagccatggggtcgtctggaggcttggcgcgagagaggccctgtcgatggcttgggctacaagtttgagcttgtcactgacaatggccctagtagcagcattaccattgccgaagctacattgagtgtcaaaaggggcggagagttttgcatcgacagtcgactattgagagactcgggtttgaattactcgaggtctccggttaaagggtttgtgatgggatcgagcgtcgagggggaaggaaaggtgagcaagcctatggtgcaagtaggagtgcaacatgtaacatgtatggctgatgctgctctatttgtagcactttctgccgccattgatcttagcatggatgcttgccaactcttctcacataaacttaggaaggagctttgccatgatgaacagaatttcttgtcctag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
DUF1005

Protein Analysis

421

Amino Acids

46.1

Weight (kDa)

9.57

Isoelectric Point (pI)

41.56

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0014428)

Species Orthologous Gene IDs
arabidopsis_thaliana AT4G29310 AT4G29310
fragaria_vesca FvH4_1g06490
malus_domestica MD02G1068200.v1.1 MD15G1199800.v1.1
prunus_persica Prupe.7G217400_v2.0.a1
pyrus_communis pycom15g17730
rosa_chinensis RchiOBHm_Chr2g0092241
rosa_laevigata RLG00000016289
rosa_multiflora Rmu_sc0000524.1_g000029
rosa_roxburghii Rroxscaffold_2G00149340
rosa_rugosa Rorug02G0024000
rosa_samantha Rh2AG069800 Rh2BG069300 Rh2CG070500 Rh2DG068200
rosa_wichuraiana Rw2G006240

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 65
AccI GTMKAC 3 cut(s) 33, 279, 1009
AccII CGCG 3 cut(s) 362, 379, 879
AccIII TCCGGA 1 cut(s) 80
AciI CCGC 9 cut(s) 289, 318, 362, 377, 435, 538, 734, 987, 1176
AclWI GGATC 6 cut(s) 12, 131, 379, 464, 477, 1078
AcoI YGGCCR 1 cut(s) 363
AcsI RAATTY 1 cut(s) 1252
AcuI CTGAAG 1 cut(s) 68
AfaI GTAC 1 cut(s) 762
AfiI CCNNNNNNNGG 5 cut(s) 21, 438, 770, 896, 1055
AflIII ACRYGT 3 cut(s) 302, 1129, 1136
AgsI TTSAA 2 cut(s) 217, 1033
AjnI CCWGG 3 cut(s) 219, 437, 673
AjuI GAANNNNNNNTTGG 2 cut(s) 135, 167
AluBI AGCT 8 cut(s) 52, 118, 168, 406, 564, 919, 965, 1234
AluI AGCT 8 cut(s) 52, 118, 168, 406, 564, 919, 965, 1234
Alw26I GTCTC 4 cut(s) 164, 790, 1014, 1050
AlwI GGATC 6 cut(s) 12, 131, 379, 464, 477, 1078
Ama87I CYCGRG 5 cut(s) 407, 769, 799, 1024, 1039
Aor13HI TCCGGA 1 cut(s) 80
AoxI GGCC 5 cut(s) 331, 363, 671, 886, 934
ApeKI GCWGC 5 cut(s) 442, 564, 737, 945, 1151
ApoI RAATTY 1 cut(s) 1252
Asp700I GAANNNNTTC 1 cut(s) 652
AspLEI GCGC 3 cut(s) 208, 235, 879
AspS9I GGNCC 6 cut(s) 223, 331, 454, 774, 887, 935
AsuC2I CCSGG 8 cut(s) 335, 458, 475, 770, 771, 782, 800, 801
AsuHPI GGTGA 5 cut(s) 304, 610, 671, 717, 1108
AvaI CYCGRG 5 cut(s) 407, 769, 799, 1024, 1039
AvaII GGWCC 3 cut(s) 223, 454, 774
BamHI GGATCC 2 cut(s) 4, 469
BbvCI CCTCAGC 4 cut(s) 119, 202, 236, 344
BbvI GCAGC 5 cut(s) 429, 551, 724, 957, 1138
BccI CCATC 5 cut(s) 266, 286, 633, 890, 1060
BcgI CGANNNNNNTGC 2 cut(s) 337, 371
BciT130I CCWGG 3 cut(s) 221, 439, 675
BclI TGATCA 1 cut(s) 747
BcnI CCSGG 8 cut(s) 335, 458, 475, 770, 771, 782, 800, 801
BcoDI GTCTC 4 cut(s) 164, 790, 1014, 1050
BfaI CTAG 3 cut(s) 789, 939, 1264
BfmI CTRYAG 1 cut(s) 72
BfuAI ACCTGC 1 cut(s) 65
BisI GCNGC 8 cut(s) 363, 443, 565, 735, 738, 946, 1152, 1176
BlsI GCNGC 8 cut(s) 364, 444, 566, 736, 739, 947, 1153, 1177
Bme18I GGWCC 3 cut(s) 223, 454, 774
BmeT110I CYCGRG 5 cut(s) 407, 769, 799, 1024, 1039
BmgT120I GGNCC 6 cut(s) 223, 331, 454, 774, 887, 935
BmiI GGNNCC 5 cut(s) 6, 79, 225, 471, 775
BmsI GCATC 3 cut(s) 1008, 1138, 1186
BpmI CTGGAG 2 cut(s) 148, 887
Bpu10I CCTNAGC 4 cut(s) 119, 202, 236, 344
BpuMI CCSGG 8 cut(s) 335, 458, 475, 770, 771, 782, 800, 801
BsaBI GATNNNNATC 1 cut(s) 598
BsaI GGTCTC 2 cut(s) 790, 1050
BsaJI CCNNGG 6 cut(s) 473, 768, 769, 770, 799, 854
BsaWI WCCGGW 5 cut(s) 80, 466, 502, 514, 1048
BsaXI ACNNNNNCTCC 2 cut(s) 413, 443
Bsc4I CCNNNNNNNGG 5 cut(s) 21, 438, 770, 896, 1055
Bse1I ACTGG 1 cut(s) 851
Bse3DI GCAATG 1 cut(s) 954
Bse8I GATNNNNATC 1 cut(s) 598
BseAI TCCGGA 1 cut(s) 80
BseBI CCWGG 3 cut(s) 221, 439, 675
BseDI CCNNGG 6 cut(s) 473, 768, 769, 770, 799, 854
BseGI GGATG 5 cut(s) 297, 405, 644, 702, 1201
BseJI GATNNNNATC 1 cut(s) 598
BseLI CCNNNNNNNGG 5 cut(s) 21, 438, 770, 896, 1055
BseMI GCAATG 1 cut(s) 954
BseMII CTCAG 6 cut(s) 110, 169, 216, 227, 358, 832
BseNI ACTGG 1 cut(s) 851
BseRI GAGGAG 3 cut(s) 82, 421, 658
BseXI GCAGC 5 cut(s) 429, 551, 724, 957, 1138
BseYI CCCAGC 1 cut(s) 328
BsgI GTGCAG 1 cut(s) 428
Bsh1236I CGCG 3 cut(s) 362, 379, 879
Bsh1285I CGRYCG 2 cut(s) 583, 781
BshFI GGCC 5 cut(s) 333, 365, 673, 888, 936
BsiEI CGRYCG 2 cut(s) 583, 781
BsiHKCI CYCGRG 5 cut(s) 407, 769, 799, 1024, 1039
BslFI GGGAC 1 cut(s) 751
BslI CCNNNNNNNGG 5 cut(s) 21, 438, 770, 896, 1055
BsmAI GTCTC 4 cut(s) 164, 790, 1014, 1050
BsmFI GGGAC 1 cut(s) 751
BsnI GGCC 5 cut(s) 333, 365, 673, 888, 936
Bso31I GGTCTC 2 cut(s) 790, 1050
BsoBI CYCGRG 5 cut(s) 407, 769, 799, 1024, 1039
Bsp13I TCCGGA 1 cut(s) 80
Bsp19I CCATGG 1 cut(s) 854
BspACI CCGC 9 cut(s) 289, 318, 362, 377, 435, 538, 734, 987, 1176
BspANI GGCC 5 cut(s) 333, 365, 673, 888, 936
BspCNI CTCAG 6 cut(s) 111, 168, 215, 228, 357, 831
BspEI TCCGGA 1 cut(s) 80
BspFNI CGCG 3 cut(s) 362, 379, 879
BspHI TCATGA 1 cut(s) 709
BspLI GGNNCC 5 cut(s) 6, 79, 225, 471, 775
BspMAI CTGCAG 1 cut(s) 76
BspMI ACCTGC 1 cut(s) 65
BspPI GGATC 6 cut(s) 12, 131, 379, 464, 477, 1078
BspTNI GGTCTC 2 cut(s) 790, 1050
BsrDI GCAATG 1 cut(s) 954
BsrI ACTGG 1 cut(s) 851
BssECI CCNNGG 6 cut(s) 473, 768, 769, 770, 799, 854
BssNAI GTATAC 1 cut(s) 280
BssT1I CCWWGG 1 cut(s) 854
Bst1107I GTATAC 1 cut(s) 280
Bst2UI CCWGG 3 cut(s) 221, 439, 675
Bst4CI ACNGT 4 cut(s) 454, 584, 765, 1007
Bst6I CTCTTC 1 cut(s) 1214
BstAPI GCANNNNNTGC 1 cut(s) 1172
BstC8I GCNNGC 6 cut(s) 72, 116, 377, 551, 1103, 1201
BstDEI CTNAG 8 cut(s) 119, 155, 202, 236, 344, 818, 1187, 1223
BstDSI CCRYGG 1 cut(s) 854
BstENI CCTNNNNNAGG 1 cut(s) 436
BstF5I GGATG 5 cut(s) 297, 405, 644, 702, 1201
BstFNI CGCG 3 cut(s) 362, 379, 879
BstHHI GCGC 3 cut(s) 208, 235, 879
BstMAI GTCTC 4 cut(s) 164, 790, 1014, 1050
BstMCI CGRYCG 2 cut(s) 583, 781
BstMWI GCNNNNNNNGC 6 cut(s) 262, 885, 942, 1111, 1151, 1172
BstNI CCWGG 3 cut(s) 221, 439, 675
BstNSI RCATGY 3 cut(s) 306, 1133, 1140
BstSFI CTRYAG 1 cut(s) 72
BstUI CGCG 3 cut(s) 362, 379, 879
BstV1I GCAGC 5 cut(s) 429, 551, 724, 957, 1138
BstX2I RGATCY 2 cut(s) 4, 469
BstYI RGATCY 2 cut(s) 4, 469
BstZ17I GTATAC 1 cut(s) 280
BsuRI GGCC 5 cut(s) 333, 365, 673, 888, 936
BtgI CCRYGG 1 cut(s) 854
BtsCI GGATG 5 cut(s) 297, 405, 644, 702, 1201
BtsIMutI CAGTG 2 cut(s) 580, 924
BveI ACCTGC 1 cut(s) 65
Cac8I GCNNGC 6 cut(s) 72, 116, 377, 551, 1103, 1201
CciI TCATGA 1 cut(s) 709
CfoI GCGC 3 cut(s) 208, 235, 879
Cfr13I GGNCC 6 cut(s) 223, 331, 454, 774, 887, 935
Cfr9I CCCGGG 2 cut(s) 769, 799
CpoI CGGWCCG 1 cut(s) 454
CseI GACGC 2 cut(s) 368, 1066
Csp6I GTAC 1 cut(s) 761
CspI CGGWCCG 1 cut(s) 454
CviQI GTAC 1 cut(s) 761
DdeI CTNAG 8 cut(s) 119, 155, 202, 236, 344, 818, 1187, 1223
EaeI YGGCCR 1 cut(s) 363
Eam1104I CTCTTC 1 cut(s) 1214
EarI CTCTTC 1 cut(s) 1214
EciI GGCGGA 3 cut(s) 304, 424, 1002
Eco130I CCWWGG 1 cut(s) 854
Eco147I AGGCCT 1 cut(s) 673
Eco31I GGTCTC 2 cut(s) 790, 1050
Eco47I GGWCC 3 cut(s) 223, 454, 774
Eco57I CTGAAG 1 cut(s) 68
Eco88I CYCGRG 5 cut(s) 407, 769, 799, 1024, 1039
EcoNI CCTNNNNNAGG 1 cut(s) 436
EcoO109I RGGNCCY 1 cut(s) 887
EcoRII CCWGG 3 cut(s) 219, 437, 673
EcoT14I CCWWGG 1 cut(s) 854
ErhI CCWWGG 1 cut(s) 854
FaqI GGGAC 1 cut(s) 751
FauI CCCGC 3 cut(s) 311, 384, 531
FbaI TGATCA 1 cut(s) 747
FblI GTMKAC 3 cut(s) 33, 279, 1009
Fnu4HI GCNGC 8 cut(s) 363, 443, 565, 735, 738, 946, 1152, 1176
FokI GGATG 5 cut(s) 304, 412, 651, 709, 1208
Fsp4HI GCNGC 8 cut(s) 363, 443, 565, 735, 738, 946, 1152, 1176
FspBI CTAG 3 cut(s) 789, 939, 1264
GlaI GCGC 3 cut(s) 207, 234, 878
GluI GCNGC 8 cut(s) 363, 443, 565, 735, 738, 946, 1152, 1176
GsaI CCCAGC 1 cut(s) 332
GsuI CTGGAG 2 cut(s) 148, 887
HaeIII GGCC 5 cut(s) 333, 365, 673, 888, 936
HgaI GACGC 2 cut(s) 368, 1066
HhaI GCGC 3 cut(s) 208, 235, 879
Hin6I GCGC 3 cut(s) 206, 233, 877
HinP1I GCGC 3 cut(s) 206, 233, 877
HincII GTYRAC 3 cut(s) 34, 340, 1010
HindII GTYRAC 3 cut(s) 34, 340, 1010
HindIII AAGCTT 1 cut(s) 50
HinfI GANTC 8 cut(s) 35, 179, 191, 309, 412, 529, 594, 1022
HphI GGTGA 5 cut(s) 304, 610, 671, 717, 1108
Hpy166II GTNNAC 7 cut(s) 34, 88, 198, 280, 340, 841, 1010
Hpy188I TCNGA 4 cut(s) 528, 599, 778, 821
Hpy188III TCNNGA 9 cut(s) 81, 127, 188, 249, 356, 409, 591, 710, 866
Hpy8I GTNNAC 7 cut(s) 34, 88, 198, 280, 340, 841, 1010
Hpy99I CGWCG 2 cut(s) 362, 1082
HpyAV CCTTC 4 cut(s) 161, 672, 1082, 1222
HpyCH4III ACNGT 4 cut(s) 454, 584, 765, 1007
HpyCH4V TGCA 6 cut(s) 74, 445, 567, 999, 1114, 1126
HpyF10VI GCNNNNNNNGC 6 cut(s) 262, 885, 942, 1111, 1151, 1172
HpyF3I CTNAG 8 cut(s) 119, 155, 202, 236, 344, 818, 1187, 1223
HspAI GCGC 3 cut(s) 206, 233, 877
Kpn2I TCCGGA 1 cut(s) 80
Ksp22I TGATCA 1 cut(s) 747
LmnI GCTCC 2 cut(s) 270, 1231
Lsp1109I GCAGC 5 cut(s) 429, 551, 724, 957, 1138
LweI GCATC 3 cut(s) 1008, 1138, 1186
MaeI CTAG 3 cut(s) 789, 939, 1264
MaeIII GTNAC 3 cut(s) 310, 922, 1132
MboII GAAGA 1 cut(s) 1201
MflI RGATCY 2 cut(s) 4, 469
MluCI AATT 4 cut(s) 586, 705, 1033, 1252
MlyI GAGTC 6 cut(s) 29, 173, 185, 318, 421, 1016
MmeI TCCRAC 2 cut(s) 674, 801
MroI TCCGGA 1 cut(s) 80
MroXI GAANNNNTTC 1 cut(s) 652
MseI TTAA 1 cut(s) 1053
MspA1I CMGCKG 1 cut(s) 318
MvaI CCWGG 3 cut(s) 221, 439, 675
MvnI CGCG 3 cut(s) 362, 379, 879
MwoI GCNNNNNNNGC 6 cut(s) 262, 885, 942, 1111, 1151, 1172
NciI CCSGG 8 cut(s) 335, 458, 475, 770, 771, 782, 800, 801
NcoI CCATGG 1 cut(s) 854
NlaIV GGNNCC 5 cut(s) 6, 79, 225, 471, 775
NmuCI GTSAC 2 cut(s) 310, 922
NspI RCATGY 3 cut(s) 306, 1133, 1140
PaeR7I CTCGAG 1 cut(s) 1039
PagI TCATGA 1 cut(s) 709
PceI AGGCCT 1 cut(s) 673
PciI ACATGT 3 cut(s) 302, 1129, 1136
PdmI GAANNNNTTC 1 cut(s) 652
PfeI GAWTC 2 cut(s) 529, 594
PflFI GACNNNGTC 1 cut(s) 782
PkrI GCNGC 8 cut(s) 364, 444, 566, 736, 739, 947, 1153, 1177
PleI GAGTC 6 cut(s) 29, 173, 185, 317, 420, 1016
PpsI GAGTC 6 cut(s) 29, 173, 185, 317, 420, 1016
PscI ACATGT 3 cut(s) 302, 1129, 1136
Psp6I CCWGG 3 cut(s) 219, 437, 673
PspFI CCCAGC 1 cut(s) 328
PspGI CCWGG 3 cut(s) 219, 437, 673
PspN4I GGNNCC 5 cut(s) 6, 79, 225, 471, 775
PspPI GGNCC 6 cut(s) 223, 331, 454, 774, 887, 935
PspXI VCTCGAGB 1 cut(s) 1039
PstI CTGCAG 1 cut(s) 76
PsuI RGATCY 2 cut(s) 4, 469
PsyI GACNNNGTC 1 cut(s) 782
RsaI GTAC 1 cut(s) 762
RsaNI GTAC 1 cut(s) 761
Rsr2I CGGWCCG 1 cut(s) 454
RsrII CGGWCCG 1 cut(s) 454
SalI GTCGAC 2 cut(s) 32, 1008
SaqAI TTAA 1 cut(s) 1053
SatI GCNGC 8 cut(s) 363, 443, 565, 735, 738, 946, 1152, 1176
Sau96I GGNCC 6 cut(s) 223, 331, 454, 774, 887, 935
SbfI CCTGCAGG 1 cut(s) 76
SchI GAGTC 6 cut(s) 29, 173, 185, 318, 421, 1016
SdaI CCTGCAGG 1 cut(s) 76
SfaNI GCATC 3 cut(s) 1008, 1138, 1186
SfcI CTRYAG 1 cut(s) 72
Sfr274I CTCGAG 1 cut(s) 1039
SinI GGWCC 3 cut(s) 223, 454, 774
SlaI CTCGAG 1 cut(s) 1039
SmaI CCCGGG 2 cut(s) 771, 801
SmlI CTYRAG 1 cut(s) 1039
SmoI CTYRAG 1 cut(s) 1039
Sse8387I CCTGCAGG 1 cut(s) 76
Sse9I AATT 4 cut(s) 586, 705, 1033, 1252
SseBI AGGCCT 1 cut(s) 673
SsiI CCGC 9 cut(s) 289, 318, 362, 377, 435, 538, 734, 987, 1176
SspMI CTAG 3 cut(s) 789, 939, 1264
StuI AGGCCT 1 cut(s) 673
StyI CCWWGG 1 cut(s) 854
TaaI ACNGT 4 cut(s) 454, 584, 765, 1007
TaqI TCGA 8 cut(s) 33, 357, 894, 1002, 1009, 1040, 1073, 1080
TasI AATT 4 cut(s) 586, 705, 1033, 1252
TauI GCSGC 3 cut(s) 365, 737, 1178
TfiI GAWTC 2 cut(s) 529, 594
Tru1I TTAA 1 cut(s) 1053
Tru9I TTAA 1 cut(s) 1053
TscAI CASTG 2 cut(s) 580, 931
TseFI GTSAC 2 cut(s) 310, 922
TseI GCWGC 5 cut(s) 442, 564, 737, 945, 1151
Tsp45I GTSAC 2 cut(s) 310, 922
TspDTI ATGAA 3 cut(s) 416, 698, 1260
TspGWI ACGGA 1 cut(s) 257
TspMI CCCGGG 2 cut(s) 769, 799
TspRI CASTG 2 cut(s) 580, 931
Tth111I GACNNNGTC 1 cut(s) 782
VpaK11BI GGWCC 3 cut(s) 223, 454, 774
XagI CCTNNNNNAGG 1 cut(s) 436
XapI RAATTY 1 cut(s) 1252
XceI RCATGY 3 cut(s) 306, 1133, 1140
XhoI CTCGAG 1 cut(s) 1039
XmaI CCCGGG 2 cut(s) 769, 799
XmiI GTMKAC 3 cut(s) 33, 279, 1009
XmnI GAANNNNTTC 1 cut(s) 652
XspI CTAG 3 cut(s) 789, 939, 1264
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.