Rmu_sc0001353.1_g000006

(-)-alpha-pinene synthase-like

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0001353.1
OG0025508
Physical Location & Seq
Forward (+)
25475 .. 26003
529 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 354 bp
atggatgatatatatgatgcattcggtacattcgaagaactcgtcatcttaactgaagcaattgagagatgggatgctagttgcatggatcaactgccagactatatgcaaccattttatctaacacttctggatgttgtcaatgaagttggggaggaactgataaagcaaggaagatcataccaactttactatgtaaaagaaattgcgaccagactccggcgaccggtgaccggactccggcgaagggtgaccggattcctgcgaccggtgaccggattccgggaaccggtaaccgaaatccggcgaccgatgactggaatccggaatccggctattattgccccccagtaa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko00909 map00909
Pfam Domains
Protein Families
Terpene_synth Terpene_synth_C

Protein Analysis

117

Amino Acids

13.64

Weight (kDa)

5.19

Isoelectric Point (pI)

89.35

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Terpene_synth_C PF03936 1 - 73 1.2e-22 Terpene synthase family, metal binding domain
Terpene_syn_C_2 PF19086 1 - 68 5.4e-13 Terpene synthase family 2, C-terminal metal binding
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0025508)

Species Orthologous Gene IDs
rosa_multiflora Rmu_sc0001353.1_g000006
rosa_samantha Rh3DG327900 Rh3DG328400

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccIII TCCGGA 1 cut(s) 324
AclWI GGATC 1 cut(s) 96
AcuI CTGAAG 1 cut(s) 75
AfaI GTAC 1 cut(s) 28
AgeI ACCGGT 3 cut(s) 226, 268, 289
AlwI GGATC 1 cut(s) 96
Aor13HI TCCGGA 1 cut(s) 324
ArsI GACNNNNNNTTYG 2 cut(s) 27, 59
AsiGI ACCGGT 3 cut(s) 226, 268, 289
AsuC2I CCSGG 1 cut(s) 284
AsuHPI GGTGA 3 cut(s) 241, 262, 283
AsuII TTCGAA 1 cut(s) 33
BccI CCATC 1 cut(s) 63
BcnI CCSGG 1 cut(s) 284
BfaI CTAG 1 cut(s) 78
Bme1390I CCNGG 1 cut(s) 284
BmiI GGNNCC 1 cut(s) 288
BmrFI CCNGG 1 cut(s) 284
BmrI ACTGGG 1 cut(s) 343
BmsI GCATC 2 cut(s) 7, 64
BmuI ACTGGG 1 cut(s) 343
Bpu14I TTCGAA 1 cut(s) 33
BpuMI CCSGG 1 cut(s) 284
BsaWI WCCGGW 7 cut(s) 226, 233, 254, 268, 275, 289, 324
Bse118I RCCGGY 3 cut(s) 226, 268, 289
Bse1I ACTGG 2 cut(s) 322, 349
BseAI TCCGGA 1 cut(s) 324
BseGI GGATG 3 cut(s) 10, 79, 139
BseNI ACTGG 2 cut(s) 322, 349
Bsh1285I CGRYCG 3 cut(s) 227, 269, 311
BshTI ACCGGT 3 cut(s) 226, 268, 289
BsiEI CGRYCG 3 cut(s) 227, 269, 311
BsmI GAATGC 1 cut(s) 20
Bsp119I TTCGAA 1 cut(s) 33
Bsp13I TCCGGA 1 cut(s) 324
Bsp143I GATC 2 cut(s) 88, 176
BspEI TCCGGA 1 cut(s) 324
BspLI GGNNCC 1 cut(s) 288
BspPI GGATC 1 cut(s) 96
BspT104I TTCGAA 1 cut(s) 33
BsrFI RCCGGY 3 cut(s) 226, 268, 289
BsrI ACTGG 2 cut(s) 322, 349
BssAI RCCGGY 3 cut(s) 226, 268, 289
BssMI GATC 2 cut(s) 88, 176
BstBI TTCGAA 1 cut(s) 33
BstEII GGTNACC 4 cut(s) 229, 250, 271, 292
BstF5I GGATG 3 cut(s) 10, 79, 139
BstKTI GATC 2 cut(s) 91, 179
BstMBI GATC 2 cut(s) 88, 176
BstMCI CGRYCG 3 cut(s) 227, 269, 311
BstMWI GCNNNNNNNGC 1 cut(s) 341
BstPI GGTNACC 4 cut(s) 229, 250, 271, 292
BstSCI CCNGG 1 cut(s) 282
BtsCI GGATG 3 cut(s) 10, 79, 139
Cfr10I RCCGGY 3 cut(s) 226, 268, 289
Csp6I GTAC 1 cut(s) 27
CspAI ACCGGT 3 cut(s) 226, 268, 289
CviAII CATG 1 cut(s) 85
CviJI RGCY 1 cut(s) 335
CviKI_1 RGCY 1 cut(s) 335
CviQI GTAC 1 cut(s) 27
DpnI GATC 2 cut(s) 90, 178
DpnII GATC 2 cut(s) 88, 176
Eco57I CTGAAG 1 cut(s) 75
Eco91I GGTNACC 4 cut(s) 229, 250, 271, 292
EcoO65I GGTNACC 4 cut(s) 229, 250, 271, 292
EcoT22I ATGCAT 1 cut(s) 22
FaeI CATG 1 cut(s) 88
FaiI YATR 8 cut(s) 11, 13, 15, 86, 105, 107, 181, 195
FatI CATG 1 cut(s) 84
FokI GGATG 3 cut(s) 17, 86, 146
FspBI CTAG 1 cut(s) 78
Hin1II CATG 1 cut(s) 88
HinfI GANTC 6 cut(s) 216, 237, 258, 279, 321, 328
HphI GGTGA 3 cut(s) 241, 262, 283
Hpy188III TCNNGA 2 cut(s) 131, 325
HpyAV CCTTC 1 cut(s) 240
HpyCH4V TGCA 3 cut(s) 20, 84, 109
HpyF10VI GCNNNNNNNGC 1 cut(s) 341
Hsp92II CATG 1 cut(s) 88
Kpn2I TCCGGA 1 cut(s) 324
Kzo9I GATC 2 cut(s) 88, 176
LweI GCATC 2 cut(s) 7, 64
MaeI CTAG 1 cut(s) 78
MaeIII GTNAC 4 cut(s) 229, 250, 271, 292
MalI GATC 2 cut(s) 90, 178
MboI GATC 2 cut(s) 88, 176
MboII GAAGA 2 cut(s) 47, 186
MfeI CAATTG 1 cut(s) 60
MluCI AATT 2 cut(s) 60, 204
MlyI GAGTC 2 cut(s) 210, 231
MnlI CCTC 1 cut(s) 148
Mph1103I ATGCAT 1 cut(s) 22
MroI TCCGGA 1 cut(s) 324
MseI TTAA 1 cut(s) 50
MspR9I CCNGG 1 cut(s) 284
MunI CAATTG 1 cut(s) 60
Mva1269I GAATGC 1 cut(s) 20
MwoI GCNNNNNNNGC 1 cut(s) 341
NciI CCSGG 1 cut(s) 284
NdeII GATC 2 cut(s) 88, 176
NlaIII CATG 1 cut(s) 88
NlaIV GGNNCC 1 cut(s) 288
NmuCI GTSAC 3 cut(s) 229, 250, 271
NsiI ATGCAT 1 cut(s) 22
NspV TTCGAA 1 cut(s) 33
PcsI WCGNNNNNNNCGW 2 cut(s) 30, 39
PctI GAATGC 1 cut(s) 20
PfeI GAWTC 4 cut(s) 258, 279, 321, 328
PfoI TCCNGGA 1 cut(s) 282
PinAI ACCGGT 3 cut(s) 226, 268, 289
PleI GAGTC 2 cut(s) 210, 231
PpsI GAGTC 2 cut(s) 210, 231
PspEI GGTNACC 4 cut(s) 229, 250, 271, 292
PspN4I GGNNCC 1 cut(s) 288
RsaI GTAC 1 cut(s) 28
RsaNI GTAC 1 cut(s) 27
SaqAI TTAA 1 cut(s) 50
Sau3AI GATC 2 cut(s) 88, 176
SchI GAGTC 2 cut(s) 210, 231
ScrFI CCNGG 1 cut(s) 284
SfaNI GCATC 2 cut(s) 7, 64
SfuI TTCGAA 1 cut(s) 33
Sse9I AATT 2 cut(s) 60, 204
SspMI CTAG 1 cut(s) 78
StyD4I CCNGG 1 cut(s) 282
TaqI TCGA 1 cut(s) 33
TaqII GACCGA 1 cut(s) 325
TasI AATT 2 cut(s) 60, 204
TfiI GAWTC 4 cut(s) 258, 279, 321, 328
Tru1I TTAA 1 cut(s) 50
Tru9I TTAA 1 cut(s) 50
TseFI GTSAC 3 cut(s) 229, 250, 271
Tsp45I GTSAC 3 cut(s) 229, 250, 271
TspDTI ATGAA 1 cut(s) 159
XspI CTAG 1 cut(s) 78
Zsp2I ATGCAT 1 cut(s) 22
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.