Rmu_sc0001371.1_g000015

Receptor protein kinase-like protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0001371.1
OG0031126
Physical Location & Seq
Reverse (-)
79172 .. 80263
1092 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0001371.1_g000015.1.cds

Sequence Viewer

Length: 1092 bp
atgaatcagctcaatggtaatatgagagaccttaaccctataaataagctttcaggaactatccctagagagatagggcacttgagatctcttgtatacctagatttgtctggtcatcgactccatggttcaattccaagatcatttggtgatctgacaaatcttacctttctcgatctctctggaaataagctttctggtactattcctaaagagatagggaacttgaaaactattctcattctagacttcggccataatcaactaaatggctcaatcccaacatccttaagtaatgtgtggaatcttgaacttctccgtctatcttcaaataagctttctggcactattcccaaagaggtaggccacttgaaatccctcacgactgtggaattaaacttcaatcaacttggtggttccattcccacttcatttggtgacctgagcagcttaaaaatcttaaacctcatgagcaaccaaatctctggctcaatccctcaagaaataggaattctcaagaacttgagtgaactacaactgggtgataatcactttgttggttacttaccccaaaacctttgccaaggtggatctcttagcaatttttctgtaaccaataaccatttgattggtccaatccccaaaagcttgaaaaattgtacgagcttaatcagactccgtcttgatgggaaccaattggaaggcaatatatcacaaggcttcggcgtttatccgaatcttgattatttagatttgagcaagaataacttctatggtgaagtctcacacaattggggacaatgcccacagttgagaaccctactaattgcagggaacaaccttcctggtagcataccacctgagattggcaatgcaacccaaattcatgtactccatctttcttctaattgtttaaatgggactattccaaaggaaggcctaaagttgaggacaactaataaccattgttctgcacaatcaaggccaaaaatgcagttggtttcttatcatccaaatgcacattcctatagacagcagacattgcacttgaacaaatcattaggatttgaactgtgtaatatacgagtatag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
LRRNT_2 LRR_1 LRR_8 Pkinase Pkinase_Tyr

Protein Analysis

363

Amino Acids

39.78

Weight (kDa)

9.11

Isoelectric Point (pI)

27.5

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0031126)

Species Orthologous Gene IDs
rosa_multiflora Rmu_co8411791.1_g000001 Rmu_sc0001371.1_g000015

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 96
AclWI GGATC 1 cut(s) 598
AcoI YGGCCR 1 cut(s) 253
AcsI RAATTY 2 cut(s) 510, 882
AfaI GTAC 3 cut(s) 202, 661, 891
AfiI CCNNNNNNNGG 2 cut(s) 866, 935
AflII CTTAAG 1 cut(s) 289
AgsI TTSAA 9 cut(s) 132, 229, 311, 330, 373, 403, 652, 1051, 1070
AjnI CCWGG 1 cut(s) 844
AjuI GAANNNNNNNTTGG 2 cut(s) 1006, 1038
AleI CACNNNNGTG 1 cut(s) 386
AluBI AGCT 7 cut(s) 10, 49, 193, 337, 450, 648, 666
AluI AGCT 7 cut(s) 10, 49, 193, 337, 450, 648, 666
Alw26I GTCTC 2 cut(s) 21, 787
AlwI GGATC 1 cut(s) 598
AoxI GGCC 4 cut(s) 253, 364, 937, 983
ApeKI GCWGC 1 cut(s) 447
ApoI RAATTY 2 cut(s) 510, 882
Asp700I GAANNNNTTC 1 cut(s) 767
AspS9I GGNCC 1 cut(s) 632
AsuHPI GGTGA 4 cut(s) 161, 449, 554, 788
AvaII GGWCC 1 cut(s) 632
BaeGI GKGCMC 1 cut(s) 81
BbvI GCAGC 1 cut(s) 459
BccI CCATC 2 cut(s) 680, 903
BciT130I CCWGG 1 cut(s) 846
BcoDI GTCTC 2 cut(s) 21, 787
BfaI CTAG 3 cut(s) 66, 101, 245
BfmI CTRYAG 1 cut(s) 1027
BfrI CTTAAG 1 cut(s) 289
BglII AGATCT 1 cut(s) 86
BisI GCNGC 1 cut(s) 448
BlsI GCNGC 1 cut(s) 449
Bme1390I CCNGG 1 cut(s) 846
Bme18I GGWCC 1 cut(s) 632
BmgT120I GGNCC 1 cut(s) 632
BmiI GGNNCC 2 cut(s) 418, 692
BmrFI CCNGG 1 cut(s) 846
BmrI ACTGGG 1 cut(s) 548
BmuI ACTGGG 1 cut(s) 548
Bpu10I CCTNAGC 1 cut(s) 443
BpuEI CTTGAG 4 cut(s) 103, 483, 500, 544
BsaI GGTCTC 1 cut(s) 21
BsaJI CCNNGG 2 cut(s) 124, 583
Bsc4I CCNNNNNNNGG 2 cut(s) 866, 935
Bse1I ACTGG 1 cut(s) 543
Bse3DI GCAATG 2 cut(s) 877, 1040
BseBI CCWGG 1 cut(s) 846
BseDI CCNNGG 2 cut(s) 124, 583
BseGI GGATG 2 cut(s) 284, 1009
BseLI CCNNNNNNNGG 2 cut(s) 866, 935
BseMI GCAATG 2 cut(s) 877, 1040
BseMII CTCAG 2 cut(s) 434, 852
BseNI ACTGG 1 cut(s) 543
BseSI GKGCMC 1 cut(s) 81
BseXI GCAGC 1 cut(s) 459
BsgI GTGCAG 1 cut(s) 957
BshFI GGCC 4 cut(s) 255, 366, 939, 985
BslFI GGGAC 2 cut(s) 810, 934
BslI CCNNNNNNNGG 2 cut(s) 866, 935
BsmAI GTCTC 2 cut(s) 21, 787
BsmFI GGGAC 2 cut(s) 810, 934
BsnI GGCC 4 cut(s) 255, 366, 939, 985
Bso31I GGTCTC 1 cut(s) 21
Bsp1286I GDGCHC 1 cut(s) 81
Bsp143I GATC 5 cut(s) 86, 140, 151, 175, 590
Bsp19I CCATGG 1 cut(s) 124
BspANI GGCC 4 cut(s) 255, 366, 939, 985
BspCNI CTCAG 2 cut(s) 435, 853
BspHI TCATGA 1 cut(s) 468
BspLI GGNNCC 2 cut(s) 418, 692
BspPI GGATC 1 cut(s) 598
BspTI CTTAAG 1 cut(s) 289
BspTNI GGTCTC 1 cut(s) 21
BsrDI GCAATG 2 cut(s) 877, 1040
BsrI ACTGG 1 cut(s) 543
BssECI CCNNGG 2 cut(s) 124, 583
BssMI GATC 5 cut(s) 86, 140, 151, 175, 590
BssNAI GTATAC 1 cut(s) 97
BssT1I CCWWGG 2 cut(s) 124, 583
Bst1107I GTATAC 1 cut(s) 97
Bst2UI CCWGG 1 cut(s) 846
Bst4CI ACNGT 3 cut(s) 388, 810, 1074
BstAFI CTTAAG 1 cut(s) 289
BstAPI GCANNNNNTGC 1 cut(s) 1042
BstDEI CTNAG 3 cut(s) 443, 596, 861
BstDSI CCRYGG 1 cut(s) 124
BstEII GGTNACC 1 cut(s) 437
BstF5I GGATG 2 cut(s) 284, 1009
BstKTI GATC 5 cut(s) 89, 143, 154, 178, 593
BstMAI GTCTC 2 cut(s) 21, 787
BstMBI GATC 5 cut(s) 86, 140, 151, 175, 590
BstMWI GCNNNNNNNGC 2 cut(s) 991, 1042
BstNI CCWGG 1 cut(s) 846
BstPI GGTNACC 1 cut(s) 437
BstSCI CCNGG 1 cut(s) 844
BstSFI CTRYAG 1 cut(s) 1027
BstSLI GKGCMC 1 cut(s) 81
BstV1I GCAGC 1 cut(s) 459
BstX2I RGATCY 2 cut(s) 86, 590
BstXI CCANNNNNNTGG 2 cut(s) 485, 629
BstYI RGATCY 2 cut(s) 86, 590
BstZ17I GTATAC 1 cut(s) 97
BsuRI GGCC 4 cut(s) 255, 366, 939, 985
BtgI CCRYGG 1 cut(s) 124
BtsCI GGATG 2 cut(s) 284, 1009
CciI TCATGA 1 cut(s) 468
Cfr13I GGNCC 1 cut(s) 632
Csp6I GTAC 3 cut(s) 201, 660, 890
CspCI CAANNNNNGTGG 2 cut(s) 415, 450
CviAII CATG 3 cut(s) 125, 469, 887
CviQI GTAC 3 cut(s) 201, 660, 890
DdeI CTNAG 3 cut(s) 443, 596, 861
DpnI GATC 5 cut(s) 88, 142, 153, 177, 592
DpnII GATC 5 cut(s) 86, 140, 151, 175, 590
DraI TTTAAA 1 cut(s) 915
EaeI YGGCCR 1 cut(s) 253
Eco130I CCWWGG 2 cut(s) 124, 583
Eco147I AGGCCT 1 cut(s) 939
Eco31I GGTCTC 1 cut(s) 21
Eco47I GGWCC 1 cut(s) 632
Eco91I GGTNACC 1 cut(s) 437
EcoO65I GGTNACC 1 cut(s) 437
EcoRI GAATTC 1 cut(s) 510
EcoRII CCWGG 1 cut(s) 844
EcoT14I CCWWGG 2 cut(s) 124, 583
ErhI CCWWGG 2 cut(s) 124, 583
FaeI CATG 3 cut(s) 128, 472, 890
FalI AAGNNNNNCTT 2 cut(s) 752, 784
FaqI GGGAC 2 cut(s) 810, 934
FatI CATG 3 cut(s) 124, 468, 886
FblI GTMKAC 1 cut(s) 96
Fnu4HI GCNGC 1 cut(s) 448
FokI GGATG 2 cut(s) 271, 996
Fsp4HI GCNGC 1 cut(s) 448
FspBI CTAG 3 cut(s) 66, 101, 245
GluI GCNGC 1 cut(s) 448
HaeIII GGCC 4 cut(s) 255, 366, 939, 985
Hin1II CATG 3 cut(s) 128, 472, 890
HindIII AAGCTT 4 cut(s) 47, 191, 335, 646
HinfI GANTC 5 cut(s) 4, 120, 304, 675, 736
HphI GGTGA 4 cut(s) 161, 449, 554, 788
Hpy166II GTNNAC 2 cut(s) 97, 530
Hpy188I TCNGA 3 cut(s) 156, 674, 735
Hpy8I GTNNAC 2 cut(s) 97, 530
HpyAV CCTTC 3 cut(s) 695, 851, 929
HpyCH4III ACNGT 3 cut(s) 388, 810, 1074
HpyCH4V TGCA 6 cut(s) 830, 875, 974, 994, 1019, 1045
HpyF10VI GCNNNNNNNGC 2 cut(s) 991, 1042
HpyF3I CTNAG 3 cut(s) 443, 596, 861
Hsp92II CATG 3 cut(s) 128, 472, 890
Kzo9I GATC 5 cut(s) 86, 140, 151, 175, 590
Lsp1109I GCAGC 1 cut(s) 459
MaeI CTAG 3 cut(s) 66, 101, 245
MaeIII GTNAC 3 cut(s) 437, 560, 610
MalI GATC 5 cut(s) 88, 142, 153, 177, 592
MboI GATC 5 cut(s) 86, 140, 151, 175, 590
MboII GAAGA 2 cut(s) 318, 894
MfeI CAATTG 2 cut(s) 695, 790
MflI RGATCY 2 cut(s) 86, 590
MhlI GDGCHC 1 cut(s) 81
MlyI GAGTC 2 cut(s) 114, 669
MnlI CCTC 5 cut(s) 352, 389, 476, 507, 942
MroXI GAANNNNTTC 1 cut(s) 767
MseI TTAA 7 cut(s) 33, 290, 395, 452, 461, 668, 914
MslI CAYNNNNRTG 2 cut(s) 386, 1014
MspCI CTTAAG 1 cut(s) 289
MspR9I CCNGG 1 cut(s) 846
MunI CAATTG 2 cut(s) 695, 790
MvaI CCWGG 1 cut(s) 846
MwoI GCNNNNNNNGC 2 cut(s) 991, 1042
NcoI CCATGG 1 cut(s) 124
NdeII GATC 5 cut(s) 86, 140, 151, 175, 590
NlaIII CATG 3 cut(s) 128, 472, 890
NlaIV GGNNCC 2 cut(s) 418, 692
NmuCI GTSAC 1 cut(s) 437
OliI CACNNNNGTG 1 cut(s) 386
PagI TCATGA 1 cut(s) 468
PceI AGGCCT 1 cut(s) 939
PdmI GAANNNNTTC 1 cut(s) 767
PfeI GAWTC 3 cut(s) 4, 304, 736
PflFI GACNNNGTC 1 cut(s) 678
PkrI GCNGC 1 cut(s) 449
PleI GAGTC 2 cut(s) 114, 669
PpsI GAGTC 2 cut(s) 114, 669
Psp6I CCWGG 1 cut(s) 844
PspEI GGTNACC 1 cut(s) 437
PspGI CCWGG 1 cut(s) 844
PspN4I GGNNCC 2 cut(s) 418, 692
PspPI GGNCC 1 cut(s) 632
PsuI RGATCY 2 cut(s) 86, 590
PsyI GACNNNGTC 1 cut(s) 678
RsaI GTAC 3 cut(s) 202, 661, 891
RsaNI GTAC 3 cut(s) 201, 660, 890
RseI CAYNNNNRTG 2 cut(s) 386, 1014
SaqAI TTAA 7 cut(s) 33, 290, 395, 452, 461, 668, 914
SatI GCNGC 1 cut(s) 448
Sau3AI GATC 5 cut(s) 86, 140, 151, 175, 590
Sau96I GGNCC 1 cut(s) 632
SchI GAGTC 2 cut(s) 114, 669
ScrFI CCNGG 1 cut(s) 846
SduI GDGCHC 1 cut(s) 81
SfcI CTRYAG 1 cut(s) 1027
SinI GGWCC 1 cut(s) 632
SmiMI CAYNNNNRTG 2 cut(s) 386, 1014
SmlI CTYRAG 5 cut(s) 82, 289, 498, 515, 523
SmoI CTYRAG 5 cut(s) 82, 289, 498, 515, 523
SseBI AGGCCT 1 cut(s) 939
SspMI CTAG 3 cut(s) 66, 101, 245
StuI AGGCCT 1 cut(s) 939
StyD4I CCNGG 1 cut(s) 844
StyI CCWWGG 2 cut(s) 124, 583
TaaI ACNGT 3 cut(s) 388, 810, 1074
TaqI TCGA 2 cut(s) 118, 174
TatI WGTACW 1 cut(s) 889
TfiI GAWTC 3 cut(s) 4, 304, 736
Tru1I TTAA 7 cut(s) 33, 290, 395, 452, 461, 668, 914
Tru9I TTAA 7 cut(s) 33, 290, 395, 452, 461, 668, 914
TseFI GTSAC 1 cut(s) 437
TseI GCWGC 1 cut(s) 447
Tsp45I GTSAC 1 cut(s) 437
TspDTI ATGAA 3 cut(s) 17, 420, 875
TspGWI ACGGA 2 cut(s) 308, 668
Tth111I GACNNNGTC 1 cut(s) 678
Vha464I CTTAAG 1 cut(s) 289
VpaK11BI GGWCC 1 cut(s) 632
XapI RAATTY 2 cut(s) 510, 882
XbaI TCTAGA 1 cut(s) 244
XmiI GTMKAC 1 cut(s) 96
XmnI GAANNNNTTC 1 cut(s) 767
XspI CTAG 3 cut(s) 66, 101, 245
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.