Rmu_sc0001374.1_g000055
ERF Family

DNA RNA polymerases superfamily protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0001374.1
OG0024013
Physical Location & Seq
Reverse (-)
157020 .. 157292
273 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 273 bp
atgaaatatattggaggtctagctgaatacatacgaaaagaactgaaatcgttcaccgtggagtccattgaagaagctactttcaaggtcatcgccattgagaccaagtacaaaagacttgacaagaaggacgacaaacagacaactgcaagtaaatctgattggaaggataaaggcaagcagatcaaggatggtccaaaacaaaagaaatattgtaatcactctcgtactagcggacatgttaaagacaagtgctggatacttcatccctag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
RVP_2 RVT_1 Retrotrans_gag rve zf-CCHC

Protein Analysis

90

Amino Acids

10.5

Weight (kDa)

9.59

Isoelectric Point (pI)

35.77

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0024013)

Species Orthologous Gene IDs
fragaria_vesca FvH4_1g29101 FvH4_4g15294
rosa_multiflora Rmu_sc0001374.1_g000055

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 234
AfaI GTAC 2 cut(s) 110, 229
AflIII ACRYGT 1 cut(s) 238
AgsI TTSAA 2 cut(s) 71, 85
AluBI AGCT 2 cut(s) 23, 77
AluI AGCT 2 cut(s) 23, 77
Alw26I GTCTC 1 cut(s) 95
Asp700I GAANNNNTTC 1 cut(s) 50
AspS9I GGNCC 1 cut(s) 194
AsuHPI GGTGA 1 cut(s) 46
AvaII GGWCC 1 cut(s) 194
BccI CCATC 1 cut(s) 185
BciVI GTATCC 1 cut(s) 252
BcoDI GTCTC 1 cut(s) 95
BfaI CTAG 3 cut(s) 20, 231, 271
BfuI GTATCC 1 cut(s) 252
Bme18I GGWCC 1 cut(s) 194
BmgT120I GGNCC 1 cut(s) 194
BsaI GGTCTC 1 cut(s) 95
BsaJI CCNNGG 1 cut(s) 57
BseDI CCNNGG 1 cut(s) 57
BseGI GGATG 2 cut(s) 196, 265
BsmAI GTCTC 1 cut(s) 95
Bso31I GGTCTC 1 cut(s) 95
Bsp143I GATC 1 cut(s) 183
BspACI CCGC 1 cut(s) 234
BspTNI GGTCTC 1 cut(s) 95
BssECI CCNNGG 1 cut(s) 57
BssMI GATC 1 cut(s) 183
Bst4CI ACNGT 1 cut(s) 58
BstC8I GCNNGC 1 cut(s) 179
BstDSI CCRYGG 1 cut(s) 57
BstF5I GGATG 2 cut(s) 196, 265
BstKTI GATC 1 cut(s) 186
BstMAI GTCTC 1 cut(s) 95
BstMBI GATC 1 cut(s) 183
BstNSI RCATGY 1 cut(s) 242
BsuI GTATCC 1 cut(s) 252
BtgI CCRYGG 1 cut(s) 57
BtgZI GCGATG 1 cut(s) 76
BtsCI GGATG 2 cut(s) 196, 265
Cac8I GCNNGC 1 cut(s) 179
Cfr13I GGNCC 1 cut(s) 194
Csp6I GTAC 2 cut(s) 109, 228
CviAII CATG 1 cut(s) 239
CviJI RGCY 2 cut(s) 23, 77
CviKI_1 RGCY 2 cut(s) 23, 77
CviQI GTAC 2 cut(s) 109, 228
DpnI GATC 1 cut(s) 185
DpnII GATC 1 cut(s) 183
Eco31I GGTCTC 1 cut(s) 95
Eco47I GGWCC 1 cut(s) 194
FaeI CATG 1 cut(s) 242
FaiI YATR 3 cut(s) 9, 32, 240
FatI CATG 1 cut(s) 238
FokI GGATG 2 cut(s) 203, 252
FspBI CTAG 3 cut(s) 20, 231, 271
Hin1II CATG 1 cut(s) 242
HinfI GANTC 1 cut(s) 62
HphI GGTGA 1 cut(s) 46
Hpy166II GTNNAC 1 cut(s) 54
Hpy188I TCNGA 1 cut(s) 160
Hpy8I GTNNAC 1 cut(s) 54
HpyAV CCTTC 2 cut(s) 121, 160
HpyCH4III ACNGT 1 cut(s) 58
HpyCH4V TGCA 1 cut(s) 149
Hsp92II CATG 1 cut(s) 242
Kzo9I GATC 1 cut(s) 183
LpnPI CCDG 1 cut(s) 241
MaeI CTAG 3 cut(s) 20, 231, 271
MalI GATC 1 cut(s) 185
MboI GATC 1 cut(s) 183
MboII GAAGA 1 cut(s) 83
MlyI GAGTC 1 cut(s) 71
MnlI CCTC 1 cut(s) 8
MroXI GAANNNNTTC 1 cut(s) 50
MseI TTAA 1 cut(s) 243
NdeII GATC 1 cut(s) 183
NlaIII CATG 1 cut(s) 242
NspI RCATGY 1 cut(s) 242
PciI ACATGT 1 cut(s) 238
PdmI GAANNNNTTC 1 cut(s) 50
PleI GAGTC 1 cut(s) 70
PpsI GAGTC 1 cut(s) 70
PscI ACATGT 1 cut(s) 238
PspPI GGNCC 1 cut(s) 194
RsaI GTAC 2 cut(s) 110, 229
RsaNI GTAC 2 cut(s) 109, 228
SaqAI TTAA 1 cut(s) 243
Sau3AI GATC 1 cut(s) 183
Sau96I GGNCC 1 cut(s) 194
SchI GAGTC 1 cut(s) 71
SetI ASST 4 cut(s) 19, 25, 79, 90
SinI GGWCC 1 cut(s) 194
SsiI CCGC 1 cut(s) 234
SspI AATATT 1 cut(s) 212
SspMI CTAG 3 cut(s) 20, 231, 271
TaaI ACNGT 1 cut(s) 58
TatI WGTACW 1 cut(s) 108
Tru1I TTAA 1 cut(s) 243
Tru9I TTAA 1 cut(s) 243
TspDTI ATGAA 2 cut(s) 17, 254
VpaK11BI GGWCC 1 cut(s) 194
XceI RCATGY 1 cut(s) 242
XmnI GAANNNNTTC 1 cut(s) 50
XspI CTAG 3 cut(s) 20, 231, 271
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.