Rmu_sc0001476.1_g000005

Lignin degradation and detoxification of lignin-derived products

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0001476.1
OG0031134
Physical Location & Seq
Forward (+)
27142 .. 27649
508 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0001476.1_g000005.1.cds

Sequence Viewer

Length: 288 bp
atggtacttgggaaatttgagagaacggatacaacatggcgtcgtaaggtggattatggcaagacgtatcttcttcgcttggtgaatgctaacatcgatgccgagtttttctttgcgattgcagaacacaacctcaccgtggtcggactggacggagcctatgctaaacccatcaccacaagatacgtagtggtaacccctggacagacaatggacgtcttgctcactgcaaattcgactccagtgctctattacatgggcggcagacaaggttcgaaaaatagctag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko00053 ko01100 map00053 map01100
Pfam Domains
Protein Families
Cu-oxidase Cu-oxidase_2 Cu-oxidase_3

Protein Analysis

95

Amino Acids

10.64

Weight (kDa)

9.34

Isoelectric Point (pI)

25.46

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0031134)

Species Orthologous Gene IDs
rosa_multiflora Rmu_sc0001476.1_g000005
rosa_roxburghii Rroxscaffold_7G00167750

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AatII GACGTC 1 cut(s) 219
AciI CCGC 1 cut(s) 261
AcsI RAATTY 2 cut(s) 14, 232
AcyI GRCGYC 2 cut(s) 40, 216
AfaI GTAC 1 cut(s) 6
AfiI CCNNNNNNNGG 1 cut(s) 139
AjnI CCWGG 1 cut(s) 199
AluBI AGCT 1 cut(s) 285
AluI AGCT 1 cut(s) 285
Alw21I GWGCWC 1 cut(s) 249
ApoI RAATTY 2 cut(s) 14, 232
AsuHPI GGTGA 3 cut(s) 94, 127, 166
AsuII TTCGAA 1 cut(s) 275
Bbv12I GWGCWC 1 cut(s) 249
BccI CCATC 1 cut(s) 179
BcgI CGANNNNNNTGC 2 cut(s) 226, 260
BciT130I CCWGG 1 cut(s) 201
BciVI GTATCC 1 cut(s) 22
BfaI CTAG 1 cut(s) 286
BfuI GTATCC 1 cut(s) 22
BisI GCNGC 1 cut(s) 262
BlsI GCNGC 1 cut(s) 263
Bme1390I CCNGG 1 cut(s) 201
BmiI GGNNCC 1 cut(s) 157
BmrFI CCNGG 1 cut(s) 201
BmsI GCATC 1 cut(s) 88
BpmI CTGGAG 1 cut(s) 225
Bpu14I TTCGAA 1 cut(s) 275
Bsa29I ATCGAT 1 cut(s) 96
BsaAI YACGTR 1 cut(s) 187
BsaHI GRCGYC 2 cut(s) 40, 216
BsaJI CCNNGG 2 cut(s) 138, 199
Bsc4I CCNNNNNNNGG 1 cut(s) 139
Bse1I ACTGG 2 cut(s) 153, 242
BseBI CCWGG 1 cut(s) 201
BseCI ATCGAT 1 cut(s) 96
BseDI CCNNGG 2 cut(s) 138, 199
BseLI CCNNNNNNNGG 1 cut(s) 139
BseNI ACTGG 2 cut(s) 153, 242
BshVI ATCGAT 1 cut(s) 96
BsiHKAI GWGCWC 1 cut(s) 249
BslI CCNNNNNNNGG 1 cut(s) 139
BsmI GAATGC 1 cut(s) 91
Bsp119I TTCGAA 1 cut(s) 275
Bsp1286I GDGCHC 1 cut(s) 249
BspACI CCGC 1 cut(s) 261
BspDI ATCGAT 1 cut(s) 96
BspLI GGNNCC 1 cut(s) 157
BspT104I TTCGAA 1 cut(s) 275
BsrI ACTGG 2 cut(s) 153, 242
BssECI CCNNGG 2 cut(s) 138, 199
BssNI GRCGYC 2 cut(s) 40, 216
Bst2UI CCWGG 1 cut(s) 201
Bst4CI ACNGT 1 cut(s) 139
BstACI GRCGYC 2 cut(s) 40, 216
BstBAI YACGTR 1 cut(s) 187
BstBI TTCGAA 1 cut(s) 275
BstDSI CCRYGG 1 cut(s) 138
BstEII GGTNACC 1 cut(s) 193
BstNI CCWGG 1 cut(s) 201
BstPI GGTNACC 1 cut(s) 193
BstSCI CCNGG 1 cut(s) 199
BstSNI TACGTA 1 cut(s) 187
Bsu15I ATCGAT 1 cut(s) 96
BsuI GTATCC 1 cut(s) 22
BsuTUI ATCGAT 1 cut(s) 96
BtgI CCRYGG 1 cut(s) 138
BtsI GCAGTG 1 cut(s) 225
BtsIMutI CAGTG 2 cut(s) 225, 249
ClaI ATCGAT 1 cut(s) 96
CseI GACGC 1 cut(s) 29
Csp6I GTAC 1 cut(s) 5
CviAII CATG 2 cut(s) 36, 256
CviJI RGCY 2 cut(s) 158, 285
CviKI_1 RGCY 2 cut(s) 158, 285
CviQI GTAC 1 cut(s) 5
Eco105I TACGTA 1 cut(s) 187
Eco91I GGTNACC 1 cut(s) 193
EcoO65I GGTNACC 1 cut(s) 193
EcoRII CCWGG 1 cut(s) 199
FaeI CATG 2 cut(s) 39, 259
FaiI YATR 4 cut(s) 37, 57, 162, 257
FatI CATG 2 cut(s) 35, 255
Fnu4HI GCNGC 1 cut(s) 262
Fsp4HI GCNGC 1 cut(s) 262
FspBI CTAG 1 cut(s) 286
GluI GCNGC 1 cut(s) 262
GsuI CTGGAG 1 cut(s) 225
HgaI GACGC 1 cut(s) 29
Hin1I GRCGYC 2 cut(s) 40, 216
Hin1II CATG 2 cut(s) 39, 259
HinfI GANTC 1 cut(s) 238
HphI GGTGA 3 cut(s) 94, 127, 166
Hpy188I TCNGA 1 cut(s) 146
Hpy99I CGWCG 1 cut(s) 45
HpyCH4III ACNGT 1 cut(s) 139
HpyCH4IV ACGT 3 cut(s) 65, 186, 216
HpyCH4V TGCA 2 cut(s) 122, 230
HpySE526I ACGT 3 cut(s) 65, 186, 216
Hsp92I GRCGYC 2 cut(s) 40, 216
Hsp92II CATG 2 cut(s) 39, 259
LmnI GCTCC 1 cut(s) 155
LpnPI CCDG 4 cut(s) 134, 186, 213, 255
LweI GCATC 1 cut(s) 88
MaeI CTAG 1 cut(s) 286
MaeII ACGT 3 cut(s) 65, 186, 216
MaeIII GTNAC 1 cut(s) 193
MboII GAAGA 2 cut(s) 62, 65
MhlI GDGCHC 1 cut(s) 249
MluCI AATT 2 cut(s) 14, 232
MlyI GAGTC 1 cut(s) 232
MmeI TCCRAC 1 cut(s) 124
MnlI CCTC 1 cut(s) 143
MspR9I CCNGG 1 cut(s) 201
Mva1269I GAATGC 1 cut(s) 91
MvaI CCWGG 1 cut(s) 201
NlaIII CATG 2 cut(s) 39, 259
NlaIV GGNNCC 1 cut(s) 157
NmeAIII GCCGAG 1 cut(s) 127
NspV TTCGAA 1 cut(s) 275
PctI GAATGC 1 cut(s) 91
PkrI GCNGC 1 cut(s) 263
PleI GAGTC 1 cut(s) 232
PpsI GAGTC 1 cut(s) 232
Ppu21I YACGTR 1 cut(s) 187
Psp6I CCWGG 1 cut(s) 199
PspEI GGTNACC 1 cut(s) 193
PspGI CCWGG 1 cut(s) 199
PspN4I GGNNCC 1 cut(s) 157
RsaI GTAC 1 cut(s) 6
RsaNI GTAC 1 cut(s) 5
SatI GCNGC 1 cut(s) 262
SchI GAGTC 1 cut(s) 232
ScrFI CCNGG 1 cut(s) 201
SduI GDGCHC 1 cut(s) 249
SetI ASST 7 cut(s) 51, 68, 135, 189, 219, 274, 287
SfaNI GCATC 1 cut(s) 88
SfuI TTCGAA 1 cut(s) 275
SnaBI TACGTA 1 cut(s) 187
Sse9I AATT 2 cut(s) 14, 232
SsiI CCGC 1 cut(s) 261
SspMI CTAG 1 cut(s) 286
StyD4I CCNGG 1 cut(s) 199
TaaI ACNGT 1 cut(s) 139
TaiI ACGT 3 cut(s) 68, 189, 219
TaqI TCGA 3 cut(s) 96, 236, 275
TasI AATT 2 cut(s) 14, 232
TauI GCSGC 1 cut(s) 264
TscAI CASTG 2 cut(s) 232, 249
TspGWI ACGGA 2 cut(s) 41, 168
TspRI CASTG 2 cut(s) 232, 249
XapI RAATTY 2 cut(s) 14, 232
XspI CTAG 1 cut(s) 286
ZraI GACGTC 1 cut(s) 217
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.