Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0001665.1

Orthogroup ID

OG0020068

Physical Location & Seq

Genomic Coordinates Forward (+)

67657 .. 68761

Gene Structure 1105 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0001665.1_g000017.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 252 bp

atgaaagccgcgatggagattttgggaaatggaggattggggtcaacttacaaggatgtgatgggtactgggttgcatgtgggaggcacgtttgggttgcaagatttgatgaaagccgcgatggagattttgggaaatggaggattggggtcaacttacaaggatgtgatgggtactgggttgcatgtggtggtgaagaggatgagggagatgaatagattggggagagatggaattgatgctgaaaaatga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0000003 GO:0001558 GO:0003006 GO:0003674 GO:0003824 GO:0004672 GO:0004674 GO:0005488 GO:0005515 GO:0005575 GO:0005622 GO:0005623 GO:0005737 GO:0005886 GO:0005911 GO:0006464 GO:0006468 GO:0006793 GO:0006796 GO:0006807 GO:0006935 GO:0008150 GO:0008152 GO:0009506 GO:0009605 GO:0009856 GO:0009987 GO:0010183 GO:0010769 GO:0016020 GO:0016301 GO:0016310 GO:0016740 GO:0016772 GO:0016773 GO:0019538 GO:0022414 GO:0022603 GO:0022604 GO:0030054 GO:0030427 GO:0032501 GO:0032502 GO:0035838 GO:0036211 GO:0040008 GO:0040011 GO:0042221 GO:0042330 GO:0042802 GO:0042995 GO:0043170 GO:0043412 GO:0043900 GO:0044237 GO:0044238 GO:0044260 GO:0044267 GO:0044424 GO:0044463 GO:0044464 GO:0044706 GO:0045595 GO:0048638 GO:0048856 GO:0048868 GO:0050789 GO:0050793 GO:0050794 GO:0050896 GO:0050918 GO:0051128 GO:0051239 GO:0051286 GO:0051510 GO:0051704 GO:0055044 GO:0060284 GO:0065007 GO:0071704 GO:0071944 GO:0080092 GO:0090404 GO:0090406 GO:0120025 GO:0120038 GO:0140096 GO:1901564 GO:2000241

KEGG Pathways

Metabolic & Signaling

ko04010 ko04064 ko04620 ko04621 ko04624 ko04722 ko05133 ko05140 ko05142 ko05145 ko05152 ko05162 ko05164 map04010 map04064 map04620 map04621 map04624 map04722 map05133 map05140 map05142 map05145 map05152 map05162 map05164

Pfam Domains

Protein Families

LRRNT_2 LRR_1 LRR_8 Pkinase Pkinase_Tyr

Protein Analysis

83

Amino Acids

8.73

Weight (kDa)

8.08

Isoelectric Point (pI)

21.2

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0020068)

Species	Orthologous Gene IDs
rosa_multiflora	Rmu_sc0001665.1_g000017
rosa_roxburghii	Rroxscaffold_1G00073810 Rroxscaffold_3G00253090
rosa_samantha	Rh1BG283300 Rh5BG062900 Rh5BG126300 Rh6BG379200

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccII	CGCG	2 cut(s)	11, 119
AciI	CCGC	2 cut(s)	9, 117
AfaI	GTAC	2 cut(s)	67, 175
AsuHPI	GGTGA	1 cut(s)	205
BccI	CCATC	5 cut(s)	7, 55, 115, 163, 224
BisI	GCNGC	2 cut(s)	9, 117
BlsI	GCNGC	2 cut(s)	10, 118
BmrI	ACTGGG	2 cut(s)	78, 186
BmsI	GCATC	1 cut(s)	229
BmuI	ACTGGG	2 cut(s)	78, 186
Bse1I	ACTGG	2 cut(s)	73, 181
BseGI	GGATG	3 cut(s)	61, 169, 207
BseNI	ACTGG	2 cut(s)	73, 181
Bsh1236I	CGCG	2 cut(s)	11, 119
BspACI	CCGC	2 cut(s)	9, 117
BspFNI	CGCG	2 cut(s)	11, 119
BsrI	ACTGG	2 cut(s)	73, 181
Bst6I	CTCTTC	1 cut(s)	191
BstF5I	GGATG	3 cut(s)	61, 169, 207
BstFNI	CGCG	2 cut(s)	11, 119
BstNSI	RCATGY	2 cut(s)	80, 188
BstUI	CGCG	2 cut(s)	11, 119
BtgZI	GCGATG	2 cut(s)	26, 134
BtsCI	GGATG	3 cut(s)	61, 169, 207
Csp6I	GTAC	2 cut(s)	66, 174
CviAII	CATG	2 cut(s)	77, 185
CviJI	RGCY	2 cut(s)	8, 116
CviKI_1	RGCY	2 cut(s)	8, 116
CviQI	GTAC	2 cut(s)	66, 174
Eam1104I	CTCTTC	1 cut(s)	191
EarI	CTCTTC	1 cut(s)	191
FaeI	CATG	2 cut(s)	80, 188
FaiI	YATR	2 cut(s)	78, 186
FatI	CATG	2 cut(s)	76, 184
Fnu4HI	GCNGC	2 cut(s)	9, 117
FokI	GGATG	3 cut(s)	68, 176, 214
Fsp4HI	GCNGC	2 cut(s)	9, 117
GluI	GCNGC	2 cut(s)	9, 117
Hin1II	CATG	2 cut(s)	80, 188
HincII	GTYRAC	2 cut(s)	45, 153
HindII	GTYRAC	2 cut(s)	45, 153
HphI	GGTGA	1 cut(s)	205
Hpy166II	GTNNAC	2 cut(s)	45, 153
Hpy8I	GTNNAC	2 cut(s)	45, 153
HpyCH4IV	ACGT	1 cut(s)	89
HpyCH4V	TGCA	3 cut(s)	76, 100, 184
HpySE526I	ACGT	1 cut(s)	89
Hsp92II	CATG	2 cut(s)	80, 188
LpnPI	CCDG	2 cut(s)	54, 162
LweI	GCATC	1 cut(s)	229
MaeII	ACGT	1 cut(s)	89
MboII	GAAGA	1 cut(s)	208
MluCI	AATT	1 cut(s)	234
MnlI	CCTC	5 cut(s)	26, 77, 134, 192, 198
MvnI	CGCG	2 cut(s)	11, 119
NlaIII	CATG	2 cut(s)	80, 188
NspI	RCATGY	2 cut(s)	80, 188
PkrI	GCNGC	2 cut(s)	10, 118
RsaI	GTAC	2 cut(s)	67, 175
RsaNI	GTAC	2 cut(s)	66, 174
SatI	GCNGC	2 cut(s)	9, 117
SetI	ASST	1 cut(s)	92
SfaNI	GCATC	1 cut(s)	229
Sse9I	AATT	1 cut(s)	234
SsiI	CCGC	2 cut(s)	9, 117
TaiI	ACGT	1 cut(s)	92
TasI	AATT	1 cut(s)	234
TauI	GCSGC	2 cut(s)	11, 119
TspDTI	ATGAA	3 cut(s)	17, 125, 227
XceI	RCATGY	2 cut(s)	80, 188

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.