Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0001694.1

Orthogroup ID

OG0031149

Physical Location & Seq

Genomic Coordinates Forward (+)

195366 .. 197263

Gene Structure 1898 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0001694.1_g000036.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 1173 bp

atgacagttcgtgaaacatttgatttctccagacgttgcctaggagttggaacaaggtatgatatactagtagagttgtctagatgggagaaagatgcatgtatcaaaccagatcctgggattgatgcatacatgaaagccacatcaatggcaggacaggaaacaagtttgatcacagattatgttctcatgatacttggattagatatctgtgctgatattatggtgggtgatgacatgagaaggggaatatctggtggacaaaagaagcgtgtcacgactggcatggttggacagttccacaacctttcagattgtcatattctggatgtgtcaatggtcatctctctcttgcaacctgttcctgagacgtatgatctttttgatgatgttatccttctttccgagggtcagatagtttatcaaggcccacgtgagaatgtccttgagttctttgaatatataggattcaaatgccctgacagaaaaggtgttgcagacttcttgcaagcagcgttcagctccttccatgttggccaactacttggggaagaattaagggttccttatgataaaagacatgcccatcctgctgctgtggttaaggaaaaaacagaaatgaaagctgggacacaagctgattcagcaaagtatttgggggaaatgtttttcagtctcattaacgtcatgtttaatggagtggcagagcttgcaatgacagttttccggcttccagtgttctttaaacagagggatgccttgttctatccagtgtgtgcttttgctttgcccatttgggtgaccagaattcctgtttctgtgttggaatctgcgatatggatcatttttacatattacaccataagatttgcacctgatactagtagttactatatcaaaaacctcttgcaggccattctaggagttcccaagataaaagacggctacaaccctgctacatggatgttagaggtcagttctgctgcagttgaggttcaaaataacattgattttgccgaaatatatgcaaactctgagctgtataggagcgttcaagaacttatcaaggaattgagcacaccactcccaggctccaaggacctttacttccccacccaatactcgcaaagcttcccaactcaatgcaaggcttgctgttggaaacaacactag

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0003674 GO:0003824 GO:0005215 GO:0005575 GO:0005623 GO:0005886 GO:0006810 GO:0008150 GO:0015399 GO:0015405 GO:0016020 GO:0016021 GO:0016462 GO:0016787 GO:0016817 GO:0016818 GO:0016887 GO:0017111 GO:0022804 GO:0022857 GO:0031224 GO:0042623 GO:0042626 GO:0043492 GO:0044425 GO:0044464 GO:0051179 GO:0051234 GO:0055085 GO:0071944

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

ABC2_membrane ABC_tran ABC_trans_N PDR_assoc

Protein Analysis

390

Amino Acids

44.08

Weight (kDa)

5.3

Isoelectric Point (pI)

44.11

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0031149)

Species	Orthologous Gene IDs
rosa_multiflora	Rmu_sc0001694.1_g000036
rosa_roxburghii	Rroxscaffold_1G00025290

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccB7I	CCANNNNNTGG	1 cut(s)	116
AclWI	GGATC	2 cut(s)	107, 848
AcoI	YGGCCR	1 cut(s)	535
AcsI	RAATTY	1 cut(s)	807
AcvI	CACGTG	1 cut(s)	434
AfiI	CCNNNNNNNGG	3 cut(s)	116, 910, 1088
AgsI	TTSAA	4 cut(s)	458, 472, 998, 1055
AhlI	ACTAGT	2 cut(s)	67, 881
AjnI	CCWGG	2 cut(s)	115, 1087
AloI	GAACNNNNNNTCC	2 cut(s)	746, 778
AluBI	AGCT	6 cut(s)	522, 626, 638, 709, 1039, 1131
AluI	AGCT	6 cut(s)	522, 626, 638, 709, 1039, 1131
Alw21I	GWGCWC	1 cut(s)	1079
Alw26I	GTCTC	2 cut(s)	362, 680
AlwI	GGATC	2 cut(s)	107, 848
AlwNI	CAGNNNCTG	1 cut(s)	116
AoxI	GGCC	3 cut(s)	427, 535, 912
ApeKI	GCWGC	3 cut(s)	512, 593, 983
ApoI	RAATTY	1 cut(s)	807
AspA2I	CCTAGG	1 cut(s)	40
AspS9I	GGNCC	2 cut(s)	428, 1099
AsuHPI	GGTGA	2 cut(s)	242, 811
AvaII	GGWCC	1 cut(s)	1099
AvrII	CCTAGG	1 cut(s)	40
BalI	TGGCCA	1 cut(s)	537
BbrPI	CACGTG	1 cut(s)	434
Bbv12I	GWGCWC	1 cut(s)	1079
BbvI	GCAGC	3 cut(s)	524, 580, 970
BccI	CCATC	2 cut(s)	78, 594
BceAI	ACGGC	1 cut(s)	958
BcgI	CGANNNNNNTGC	2 cut(s)	1007, 1041
BciT130I	CCWGG	2 cut(s)	117, 1089
BclI	TGATCA	1 cut(s)	171
BcoDI	GTCTC	2 cut(s)	362, 680
BcuI	ACTAGT	2 cut(s)	67, 881
BfaI	CTAG	6 cut(s)	41, 68, 81, 882, 920, 1171
BfmI	CTRYAG	1 cut(s)	984
BisI	GCNGC	3 cut(s)	513, 594, 984
BlnI	CCTAGG	1 cut(s)	40
BlsI	GCNGC	3 cut(s)	514, 595, 985
Bme1390I	CCNGG	2 cut(s)	117, 1089
Bme18I	GGWCC	1 cut(s)	1099
BmgT120I	GGNCC	2 cut(s)	428, 1099
BmiI	GGNNCC	2 cut(s)	564, 1093
BmrFI	CCNGG	2 cut(s)	117, 1089
BmsI	GCATC	3 cut(s)	85, 115, 745
BpmI	CTGGAG	1 cut(s)	13
BpuEI	CTTGAG	1 cut(s)	467
BsaAI	YACGTR	1 cut(s)	434
BsaBI	GATNNNNATC	1 cut(s)	839
BsaJI	CCNNGG	5 cut(s)	40, 116, 405, 1087, 1095
Bsc4I	CCNNNNNNNGG	3 cut(s)	116, 910, 1088
Bse1I	ACTGG	3 cut(s)	286, 734, 770
Bse3DI	GCAATG	1 cut(s)	720
Bse8I	GATNNNNATC	1 cut(s)	839
BseBI	CCWGG	2 cut(s)	117, 1089
BseDI	CCNNGG	5 cut(s)	40, 116, 405, 1087, 1095
BseGI	GGATG	4 cut(s)	334, 586, 760, 969
BseJI	GATNNNNATC	1 cut(s)	839
BseLI	CCNNNNNNNGG	3 cut(s)	116, 910, 1088
BseMI	GCAATG	1 cut(s)	720
BseMII	CTCAG	2 cut(s)	357, 1026
BseNI	ACTGG	3 cut(s)	286, 734, 770
BseXI	GCAGC	3 cut(s)	524, 580, 970
BseYI	CCCAGC	1 cut(s)	626
BshFI	GGCC	3 cut(s)	429, 537, 914
BsiHKAI	GWGCWC	1 cut(s)	1079
BsiSI	CCGG	1 cut(s)	727
BslFI	GGGAC	1 cut(s)	643
BslI	CCNNNNNNNGG	3 cut(s)	116, 910, 1088
BsmAI	GTCTC	2 cut(s)	362, 680
BsmBI	CGTCTC	1 cut(s)	362
BsmFI	GGGAC	1 cut(s)	643
BsnI	GGCC	3 cut(s)	429, 537, 914
Bsp1286I	GDGCHC	1 cut(s)	1079
Bsp143I	GATC	4 cut(s)	112, 171, 376, 840
BspANI	GGCC	3 cut(s)	429, 537, 914
BspCNI	CTCAG	2 cut(s)	358, 1027
BspHI	TCATGA	1 cut(s)	189
BspLI	GGNNCC	2 cut(s)	564, 1093
BspMAI	CTGCAG	1 cut(s)	988
BspPI	GGATC	2 cut(s)	107, 848
BsrDI	GCAATG	1 cut(s)	720
BsrI	ACTGG	3 cut(s)	286, 734, 770
BssECI	CCNNGG	5 cut(s)	40, 116, 405, 1087, 1095
BssMI	GATC	4 cut(s)	112, 171, 376, 840
BssT1I	CCWWGG	2 cut(s)	40, 1095
Bst2UI	CCWGG	2 cut(s)	117, 1089
Bst4CI	ACNGT	3 cut(s)	7, 297, 721
BstAPI	GCANNNNNTGC	2 cut(s)	710, 1152
BstBAI	YACGTR	1 cut(s)	434
BstC8I	GCNNGC	4 cut(s)	510, 711, 912, 1153
BstDEI	CTNAG	2 cut(s)	366, 1035
BstEII	GGTNACC	1 cut(s)	799
BstENI	CCTNNNNNAGG	1 cut(s)	908
BstF5I	GGATG	4 cut(s)	334, 586, 760, 969
BstKTI	GATC	4 cut(s)	115, 174, 379, 843
BstMAI	GTCTC	2 cut(s)	362, 680
BstMBI	GATC	4 cut(s)	112, 171, 376, 840
BstMWI	GCNNNNNNNGC	4 cut(s)	590, 644, 710, 1152
BstNI	CCWGG	2 cut(s)	117, 1089
BstNSI	RCATGY	2 cut(s)	102, 584
BstPI	GGTNACC	1 cut(s)	799
BstSCI	CCNGG	2 cut(s)	115, 1087
BstSFI	CTRYAG	1 cut(s)	984
BstV1I	GCAGC	3 cut(s)	524, 580, 970
BstX2I	RGATCY	1 cut(s)	112
BstXI	CCANNNNNNTGG	2 cut(s)	148, 545
BstYI	RGATCY	1 cut(s)	112
BsuRI	GGCC	3 cut(s)	429, 537, 914
BtsCI	GGATG	4 cut(s)	334, 586, 760, 969
BtsIMutI	CAGTG	2 cut(s)	741, 777
Cac8I	GCNNGC	4 cut(s)	510, 711, 912, 1153
CaiI	CAGNNNCTG	1 cut(s)	116
CciI	TCATGA	1 cut(s)	189
Cfr13I	GGNCC	2 cut(s)	428, 1099
CviAII	CATG	9 cut(s)	99, 133, 190, 238, 286, 530, 581, 688, 960
DdeI	CTNAG	2 cut(s)	366, 1035
DpnI	GATC	4 cut(s)	114, 173, 378, 842
DpnII	GATC	4 cut(s)	112, 171, 376, 840
DraI	TTTAAA	1 cut(s)	745
EaeI	YGGCCR	1 cut(s)	535
Eco130I	CCWWGG	2 cut(s)	40, 1095
Eco32I	GATATC	1 cut(s)	208
Eco47I	GGWCC	1 cut(s)	1099
Eco72I	CACGTG	1 cut(s)	434
Eco91I	GGTNACC	1 cut(s)	799
EcoNI	CCTNNNNNAGG	1 cut(s)	908
EcoO109I	RGGNCCY	1 cut(s)	1099
EcoO65I	GGTNACC	1 cut(s)	799
EcoRI	GAATTC	1 cut(s)	807
EcoRII	CCWGG	2 cut(s)	115, 1087
EcoRV	GATATC	1 cut(s)	208
EcoT14I	CCWWGG	2 cut(s)	40, 1095
EcoT22I	ATGCAT	2 cut(s)	100, 130
ErhI	CCWWGG	2 cut(s)	40, 1095
Esp3I	CGTCTC	1 cut(s)	362
FaeI	CATG	9 cut(s)	102, 136, 193, 241, 289, 533, 584, 691, 963
FalI	AAGNNNNNCTT	2 cut(s)	550, 582
FaqI	GGGAC	1 cut(s)	643
FatI	CATG	9 cut(s)	98, 132, 189, 237, 285, 529, 580, 687, 959
FbaI	TGATCA	1 cut(s)	171
Fnu4HI	GCNGC	3 cut(s)	513, 594, 984
FokI	GGATG	4 cut(s)	341, 573, 767, 976
Fsp4HI	GCNGC	3 cut(s)	513, 594, 984
FspBI	CTAG	6 cut(s)	41, 68, 81, 882, 920, 1171
GluI	GCNGC	3 cut(s)	513, 594, 984
GsaI	CCCAGC	1 cut(s)	630
GsuI	CTGGAG	1 cut(s)	13
HaeIII	GGCC	3 cut(s)	429, 537, 914
HapII	CCGG	1 cut(s)	727
Hin1II	CATG	9 cut(s)	102, 136, 193, 241, 289, 533, 584, 691, 963
HindIII	AAGCTT	1 cut(s)	1129
HinfI	GANTC	3 cut(s)	468, 641, 827
HpaII	CCGG	1 cut(s)	727
HphI	GGTGA	2 cut(s)	242, 811
Hpy166II	GTNNAC	1 cut(s)	260
Hpy188I	TCNGA	4 cut(s)	313, 406, 414, 1036
Hpy188III	TCNNGA	8 cut(s)	11, 30, 81, 190, 277, 326, 365, 1055
Hpy8I	GTNNAC	1 cut(s)	260
HpyAV	CCTTC	3 cut(s)	237, 407, 535
HpyCH4III	ACNGT	3 cut(s)	7, 297, 721
HpyCH4IV	ACGT	4 cut(s)	34, 371, 433, 684
HpyF10VI	GCNNNNNNNGC	4 cut(s)	590, 644, 710, 1152
HpyF3I	CTNAG	2 cut(s)	366, 1035
HpySE526I	ACGT	4 cut(s)	34, 371, 433, 684
Hsp92II	CATG	9 cut(s)	102, 136, 193, 241, 289, 533, 584, 691, 963
Ksp22I	TGATCA	1 cut(s)	171
Kzo9I	GATC	4 cut(s)	112, 171, 376, 840
LmnI	GCTCC	3 cut(s)	527, 1047, 1097
Lsp1109I	GCAGC	3 cut(s)	524, 580, 970
LweI	GCATC	3 cut(s)	85, 115, 745
MaeI	CTAG	6 cut(s)	41, 68, 81, 882, 920, 1171
MaeII	ACGT	4 cut(s)	34, 371, 433, 684
MaeIII	GTNAC	3 cut(s)	274, 799, 887
MalI	GATC	4 cut(s)	114, 173, 378, 842
MboI	GATC	4 cut(s)	112, 171, 376, 840
MboII	GAAGA	1 cut(s)	563
MflI	RGATCY	1 cut(s)	112
MhlI	GDGCHC	1 cut(s)	1079
MlsI	TGGCCA	1 cut(s)	537
MluCI	AATT	3 cut(s)	554, 807, 1070
MluNI	TGGCCA	1 cut(s)	537
MmeI	TCCRAC	4 cut(s)	28, 271, 804, 1139
MnlI	CCTC	5 cut(s)	400, 744, 914, 964, 985
Mox20I	TGGCCA	1 cut(s)	537
Mph1103I	ATGCAT	2 cut(s)	100, 130
MscI	TGGCCA	1 cut(s)	537
MseI	TTAA	5 cut(s)	557, 603, 681, 693, 744
MslI	CAYNNNNRTG	2 cut(s)	146, 797
Msp20I	TGGCCA	1 cut(s)	537
MspI	CCGG	1 cut(s)	727
MspR9I	CCNGG	2 cut(s)	117, 1089
MvaI	CCWGG	2 cut(s)	117, 1089
MwoI	GCNNNNNNNGC	4 cut(s)	590, 644, 710, 1152
NdeII	GATC	4 cut(s)	112, 171, 376, 840
NlaIII	CATG	9 cut(s)	102, 136, 193, 241, 289, 533, 584, 691, 963
NlaIV	GGNNCC	2 cut(s)	564, 1093
NmuCI	GTSAC	2 cut(s)	274, 799
NsiI	ATGCAT	2 cut(s)	100, 130
NspI	RCATGY	2 cut(s)	102, 584
PagI	TCATGA	1 cut(s)	189
PfeI	GAWTC	3 cut(s)	468, 641, 827
PflMI	CCANNNNNTGG	1 cut(s)	116
PkrI	GCNGC	3 cut(s)	514, 595, 985
PmaCI	CACGTG	1 cut(s)	434
PmlI	CACGTG	1 cut(s)	434
Ppu21I	YACGTR	1 cut(s)	434
PpuMI	RGGWCCY	1 cut(s)	1099
Psp5II	RGGWCCY	1 cut(s)	1099
Psp6I	CCWGG	2 cut(s)	115, 1087
PspCI	CACGTG	1 cut(s)	434
PspEI	GGTNACC	1 cut(s)	799
PspFI	CCCAGC	1 cut(s)	626
PspGI	CCWGG	2 cut(s)	115, 1087
PspN4I	GGNNCC	2 cut(s)	564, 1093
PspPI	GGNCC	2 cut(s)	428, 1099
PspPPI	RGGWCCY	1 cut(s)	1099
PstI	CTGCAG	1 cut(s)	988
PstNI	CAGNNNCTG	1 cut(s)	116
PsuI	RGATCY	1 cut(s)	112
RseI	CAYNNNNRTG	2 cut(s)	146, 797
SaqAI	TTAA	5 cut(s)	557, 603, 681, 693, 744
SatI	GCNGC	3 cut(s)	513, 594, 984
Sau3AI	GATC	4 cut(s)	112, 171, 376, 840
Sau96I	GGNCC	2 cut(s)	428, 1099
ScrFI	CCNGG	2 cut(s)	117, 1089
SduI	GDGCHC	1 cut(s)	1079
SfaNI	GCATC	3 cut(s)	85, 115, 745
SfcI	CTRYAG	1 cut(s)	984
SinI	GGWCC	1 cut(s)	1099
SmiMI	CAYNNNNRTG	2 cut(s)	146, 797
SmlI	CTYRAG	1 cut(s)	446
SmoI	CTYRAG	1 cut(s)	446
SpeI	ACTAGT	2 cut(s)	67, 881
Sse9I	AATT	3 cut(s)	554, 807, 1070
SspMI	CTAG	6 cut(s)	41, 68, 81, 882, 920, 1171
StyD4I	CCNGG	2 cut(s)	115, 1087
StyI	CCWWGG	2 cut(s)	40, 1095
TaaI	ACNGT	3 cut(s)	7, 297, 721
TaiI	ACGT	4 cut(s)	37, 374, 436, 687
TasI	AATT	3 cut(s)	554, 807, 1070
TfiI	GAWTC	3 cut(s)	468, 641, 827
Tru1I	TTAA	5 cut(s)	557, 603, 681, 693, 744
Tru9I	TTAA	5 cut(s)	557, 603, 681, 693, 744
TscAI	CASTG	2 cut(s)	741, 777
TseFI	GTSAC	2 cut(s)	274, 799
TseI	GCWGC	3 cut(s)	512, 593, 983
Tsp45I	GTSAC	2 cut(s)	274, 799
TspDTI	ATGAA	2 cut(s)	149, 635
TspRI	CASTG	2 cut(s)	741, 777
Van91I	CCANNNNNTGG	1 cut(s)	116
VpaK11BI	GGWCC	1 cut(s)	1099
XagI	CCTNNNNNAGG	1 cut(s)	908
XapI	RAATTY	1 cut(s)	807
XbaI	TCTAGA	1 cut(s)	80
XceI	RCATGY	2 cut(s)	102, 584
XmaJI	CCTAGG	1 cut(s)	40
XspI	CTAG	6 cut(s)	41, 68, 81, 882, 920, 1171
Zsp2I	ATGCAT	2 cut(s)	100, 130

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.