Rmu_sc0001733.1_g000009

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0001733.1
OG0025399
Physical Location & Seq
Forward (+)
55837 .. 56220
384 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0001733.1_g000009.1.cds

Sequence Viewer

Length: 384 bp
atggaacatcctgggatgagccttgtgatcatttggtgtttggaggcacaaaaatggatgcatgttacaaaatcacatcaacatgagtggactagaccatcacattatgaattgatattccacagctggccgtgctcttcggttacaaaaatggatgctgatatgggccgagaacttaggcagtcgaagcaactaaaacggcagtttagtttggtcttggatcaaaaggagtcagttttgatggtccaaaaactatctgcggagattgtaaagatgcacaaggatttggaacagaaagacaagattttatcagcaatgctggggaaatcaaagttggacatatcagagaagcaaatgcttgtaaaggagattaagttgagctga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko04530 map04530
Pfam Domains
Protein Families
No domains found.

Protein Analysis

127

Amino Acids

14.93

Weight (kDa)

9.1

Isoelectric Point (pI)

50.74

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0025399)

Species Orthologous Gene IDs
rosa_laevigata RLG00000026298
rosa_multiflora Rmu_sc0001733.1_g000009
rosa_samantha Rh1AG445800

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 260
AclWI GGATC 1 cut(s) 228
AcoI YGGCCR 1 cut(s) 128
AjnI CCWGG 1 cut(s) 10
AjuI GAANNNNNNNTTGG 2 cut(s) 317, 349
AluBI AGCT 2 cut(s) 126, 381
AluI AGCT 2 cut(s) 126, 381
Alw21I GWGCWC 1 cut(s) 137
AlwI GGATC 1 cut(s) 228
AoxI GGCC 2 cut(s) 128, 166
AspS9I GGNCC 2 cut(s) 166, 244
AvaII GGWCC 1 cut(s) 244
Bbv12I GWGCWC 1 cut(s) 137
BccI CCATC 2 cut(s) 106, 235
BceAI ACGGC 2 cut(s) 115, 215
BciT130I CCWGG 1 cut(s) 12
BclI TGATCA 1 cut(s) 27
BfaI CTAG 1 cut(s) 93
Bme1390I CCNGG 1 cut(s) 12
Bme18I GGWCC 1 cut(s) 244
BmgT120I GGNCC 2 cut(s) 166, 244
BmrFI CCNGG 1 cut(s) 12
BmsI GCATC 3 cut(s) 48, 145, 264
BsaJI CCNNGG 1 cut(s) 11
BsaXI ACNNNNNCTCC 1 cut(s) 359
Bse3DI GCAATG 1 cut(s) 321
BseBI CCWGG 1 cut(s) 12
BseDI CCNNGG 1 cut(s) 11
BseGI GGATG 4 cut(s) 7, 21, 63, 160
BseMI GCAATG 1 cut(s) 321
BseYI CCCAGC 1 cut(s) 319
BshFI GGCC 2 cut(s) 130, 168
BsiHKAI GWGCWC 1 cut(s) 137
BsnI GGCC 2 cut(s) 130, 168
Bsp1286I GDGCHC 1 cut(s) 137
Bsp143I GATC 2 cut(s) 27, 220
BspACI CCGC 1 cut(s) 260
BspANI GGCC 2 cut(s) 130, 168
BspPI GGATC 1 cut(s) 228
BspQI GCTCTTC 1 cut(s) 142
BsrDI GCAATG 1 cut(s) 321
BssECI CCNNGG 1 cut(s) 11
BssMI GATC 2 cut(s) 27, 220
Bst2UI CCWGG 1 cut(s) 12
Bst6I CTCTTC 1 cut(s) 142
BstC8I GCNNGC 1 cut(s) 128
BstDEI CTNAG 1 cut(s) 176
BstF5I GGATG 4 cut(s) 7, 21, 63, 160
BstKTI GATC 2 cut(s) 30, 223
BstMBI GATC 2 cut(s) 27, 220
BstMWI GCNNNNNNNGC 2 cut(s) 132, 187
BstNI CCWGG 1 cut(s) 12
BstNSI RCATGY 1 cut(s) 65
BstSCI CCNGG 1 cut(s) 10
BsuRI GGCC 2 cut(s) 130, 168
BtsCI GGATG 4 cut(s) 7, 21, 63, 160
Cac8I GCNNGC 1 cut(s) 128
Cfr13I GGNCC 2 cut(s) 166, 244
CspCI CAANNNNNGTGG 2 cut(s) 68, 103
CviAII CATG 2 cut(s) 62, 83
CviJI RGCY 5 cut(s) 21, 126, 130, 168, 381
CviKI_1 RGCY 5 cut(s) 21, 126, 130, 168, 381
DdeI CTNAG 1 cut(s) 176
DpnI GATC 2 cut(s) 29, 222
DpnII GATC 2 cut(s) 27, 220
EaeI YGGCCR 1 cut(s) 128
Eam1104I CTCTTC 1 cut(s) 142
EarI CTCTTC 1 cut(s) 142
Eco47I GGWCC 1 cut(s) 244
EcoRII CCWGG 1 cut(s) 10
EcoT22I ATGCAT 1 cut(s) 63
FaeI CATG 2 cut(s) 65, 86
FaiI YATR 5 cut(s) 63, 84, 108, 164, 341
FatI CATG 2 cut(s) 61, 82
FbaI TGATCA 1 cut(s) 27
FokI GGATG 3 cut(s) 28, 70, 167
FspBI CTAG 1 cut(s) 93
GsaI CCCAGC 1 cut(s) 323
HaeIII GGCC 2 cut(s) 130, 168
Hin1II CATG 2 cut(s) 65, 86
HinfI GANTC 1 cut(s) 230
Hpy166II GTNNAC 1 cut(s) 90
Hpy188I TCNGA 1 cut(s) 346
Hpy8I GTNNAC 1 cut(s) 90
HpyCH4V TGCA 2 cut(s) 61, 277
HpyF10VI GCNNNNNNNGC 2 cut(s) 132, 187
HpyF3I CTNAG 1 cut(s) 176
Hsp92II CATG 2 cut(s) 65, 86
Ksp22I TGATCA 1 cut(s) 27
Kzo9I GATC 2 cut(s) 27, 220
LguI GCTCTTC 1 cut(s) 142
LpnPI CCDG 3 cut(s) 24, 112, 305
LweI GCATC 3 cut(s) 48, 145, 264
MaeI CTAG 1 cut(s) 93
MaeIII GTNAC 2 cut(s) 64, 142
MalI GATC 2 cut(s) 29, 222
MboI GATC 2 cut(s) 27, 220
MboII GAAGA 1 cut(s) 129
MhlI GDGCHC 1 cut(s) 137
MluCI AATT 1 cut(s) 110
MlyI GAGTC 1 cut(s) 239
MmeI TCCRAC 1 cut(s) 315
MnlI CCTC 1 cut(s) 37
Mph1103I ATGCAT 1 cut(s) 63
MseI TTAA 1 cut(s) 372
MslI CAYNNNNRTG 2 cut(s) 52, 81
MspA1I CMGCKG 1 cut(s) 126
MspR9I CCNGG 1 cut(s) 12
MvaI CCWGG 1 cut(s) 12
MwoI GCNNNNNNNGC 2 cut(s) 132, 187
NdeII GATC 2 cut(s) 27, 220
NlaIII CATG 2 cut(s) 65, 86
NmeAIII GCCGAG 1 cut(s) 194
NsiI ATGCAT 1 cut(s) 63
NspI RCATGY 1 cut(s) 65
PciSI GCTCTTC 1 cut(s) 142
PleI GAGTC 1 cut(s) 238
PpsI GAGTC 1 cut(s) 238
Psp6I CCWGG 1 cut(s) 10
PspFI CCCAGC 1 cut(s) 319
PspGI CCWGG 1 cut(s) 10
PspPI GGNCC 2 cut(s) 166, 244
PvuII CAGCTG 1 cut(s) 126
RseI CAYNNNNRTG 2 cut(s) 52, 81
SapI GCTCTTC 1 cut(s) 142
SaqAI TTAA 1 cut(s) 372
Sau3AI GATC 2 cut(s) 27, 220
Sau96I GGNCC 2 cut(s) 166, 244
SchI GAGTC 1 cut(s) 239
ScrFI CCNGG 1 cut(s) 12
SduI GDGCHC 1 cut(s) 137
SetI ASST 2 cut(s) 128, 383
SfaNI GCATC 3 cut(s) 48, 145, 264
SinI GGWCC 1 cut(s) 244
SmiMI CAYNNNNRTG 2 cut(s) 52, 81
Sse9I AATT 1 cut(s) 110
SsiI CCGC 1 cut(s) 260
SspMI CTAG 1 cut(s) 93
StyD4I CCNGG 1 cut(s) 10
TaqI TCGA 1 cut(s) 185
TasI AATT 1 cut(s) 110
Tru1I TTAA 1 cut(s) 372
Tru9I TTAA 1 cut(s) 372
TspDTI ATGAA 1 cut(s) 123
VpaK11BI GGWCC 1 cut(s) 244
XceI RCATGY 1 cut(s) 65
XspI CTAG 1 cut(s) 93
Zsp2I ATGCAT 1 cut(s) 63
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.