Rmu_sc0001784.1_g000017

PPIases accelerate the folding of proteins. It catalyzes the cis-trans isomerization of proline imidic peptide bonds in oligopeptides

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0001784.1
OG0031159
Physical Location & Seq
Forward (+)
59994 .. 60862
869 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0001784.1_g000017.1.cds

Sequence Viewer

Length: 342 bp
atgaatacggcccctatcgtggcggcggcggcgggagtcgtaagcggagcaagaagaggcccttcggtggattttcttgatctcgaagcggtggtcgattcagatgaggagggagagaaaggatatggttataaaagatgctcgttccaccgcatcattaaggattttatgatccaaggaggggatttcactgaaggagatggaactggagggatcagtatctatggttccaaatttgatgatgagagctttgcttgtcagttctccaagggacagtgccggtcatggcagccacacaacctctatagctgctggtcgttatgtgtcaaacatgacttataa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
GO:0005575 GO:0005622 GO:0005623 GO:0005737 GO:0009507 GO:0009532 GO:0009536 GO:0009570 GO:0043226 GO:0043227 GO:0043229 GO:0043231 GO:0044422 GO:0044424 GO:0044434 GO:0044435 GO:0044444 GO:0044446 GO:0044464
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Pro_isomerase

Protein Analysis

113

Amino Acids

12.34

Weight (kDa)

5.01

Isoelectric Point (pI)

30.33

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0031159)

Species Orthologous Gene IDs
rosa_multiflora Rmu_sc0001784.1_g000017
rosa_roxburghii Rroxscaffold_1G00052260

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 2 cut(s) 132, 340
AciI CCGC 7 cut(s) 23, 26, 29, 32, 45, 89, 151
AclWI GGATC 2 cut(s) 166, 221
AcsI RAATTY 1 cut(s) 233
AcuI CTGAAG 1 cut(s) 213
AfiI CCNNNNNNNGG 3 cut(s) 19, 67, 181
AluBI AGCT 2 cut(s) 249, 309
AluI AGCT 2 cut(s) 249, 309
AlwI GGATC 2 cut(s) 166, 221
AoxI GGCC 2 cut(s) 9, 58
ApeKI GCWGC 2 cut(s) 289, 309
ApoI RAATTY 1 cut(s) 233
ArsI GACNNNNNNTTYG 2 cut(s) 78, 110
AspS9I GGNCC 2 cut(s) 10, 59
BbvI GCAGC 2 cut(s) 296, 301
BccI CCATC 1 cut(s) 194
BceAI ACGGC 1 cut(s) 24
BfmI CTRYAG 1 cut(s) 304
BisI GCNGC 5 cut(s) 24, 27, 30, 290, 310
BlsI GCNGC 5 cut(s) 25, 28, 31, 291, 311
BmgT120I GGNCC 2 cut(s) 10, 59
BmiI GGNNCC 2 cut(s) 12, 229
BmsI GCATC 2 cut(s) 128, 162
BpmI CTGGAG 1 cut(s) 228
BsaBI GATNNNNATC 1 cut(s) 218
BsaJI CCNNGG 2 cut(s) 175, 267
Bsc4I CCNNNNNNNGG 3 cut(s) 19, 67, 181
Bse118I RCCGGY 1 cut(s) 279
Bse1I ACTGG 1 cut(s) 211
Bse8I GATNNNNATC 1 cut(s) 218
BseDI CCNNGG 2 cut(s) 175, 267
BseJI GATNNNNATC 1 cut(s) 218
BseLI CCNNNNNNNGG 3 cut(s) 19, 67, 181
BseNI ACTGG 1 cut(s) 211
BseRI GAGGAG 1 cut(s) 122
BseXI GCAGC 2 cut(s) 296, 301
BshFI GGCC 2 cut(s) 11, 60
BsiSI CCGG 1 cut(s) 280
BslFI GGGAC 1 cut(s) 285
BslI CCNNNNNNNGG 3 cut(s) 19, 67, 181
BsmFI GGGAC 1 cut(s) 285
BsnI GGCC 2 cut(s) 11, 60
Bsp143I GATC 3 cut(s) 79, 171, 213
BspACI CCGC 7 cut(s) 23, 26, 29, 32, 45, 89, 151
BspANI GGCC 2 cut(s) 11, 60
BspLI GGNNCC 2 cut(s) 12, 229
BspPI GGATC 2 cut(s) 166, 221
BsrFI RCCGGY 1 cut(s) 279
BsrI ACTGG 1 cut(s) 211
BssAI RCCGGY 1 cut(s) 279
BssECI CCNNGG 2 cut(s) 175, 267
BssMI GATC 3 cut(s) 79, 171, 213
BssT1I CCWWGG 2 cut(s) 175, 267
Bst4CI ACNGT 1 cut(s) 276
Bst6I CTCTTC 1 cut(s) 49
BstKTI GATC 3 cut(s) 82, 174, 216
BstMBI GATC 3 cut(s) 79, 171, 213
BstMWI GCNNNNNNNGC 1 cut(s) 29
BstSFI CTRYAG 1 cut(s) 304
BstV1I GCAGC 2 cut(s) 296, 301
BsuRI GGCC 2 cut(s) 11, 60
BtsIMutI CAGTG 2 cut(s) 189, 281
Cfr10I RCCGGY 1 cut(s) 279
Cfr13I GGNCC 2 cut(s) 10, 59
CviAII CATG 2 cut(s) 285, 332
CviJI RGCY 5 cut(s) 11, 60, 249, 292, 309
CviKI_1 RGCY 5 cut(s) 11, 60, 249, 292, 309
DpnI GATC 3 cut(s) 81, 173, 215
DpnII GATC 3 cut(s) 79, 171, 213
Eam1104I CTCTTC 1 cut(s) 49
EarI CTCTTC 1 cut(s) 49
Eco130I CCWWGG 2 cut(s) 175, 267
Eco57I CTGAAG 1 cut(s) 213
EcoO109I RGGNCCY 1 cut(s) 59
EcoT14I CCWWGG 2 cut(s) 175, 267
ErhI CCWWGG 2 cut(s) 175, 267
FaeI CATG 2 cut(s) 288, 335
FaiI YATR 9 cut(s) 126, 132, 170, 225, 286, 306, 322, 333, 340
FalI AAGNNNNNCTT 2 cut(s) 46, 78
FaqI GGGAC 1 cut(s) 285
FatI CATG 2 cut(s) 284, 331
FauI CCCGC 1 cut(s) 25
Fnu4HI GCNGC 5 cut(s) 24, 27, 30, 290, 310
Fsp4HI GCNGC 5 cut(s) 24, 27, 30, 290, 310
GluI GCNGC 5 cut(s) 24, 27, 30, 290, 310
GsuI CTGGAG 1 cut(s) 228
HaeIII GGCC 2 cut(s) 11, 60
HapII CCGG 1 cut(s) 280
Hin1II CATG 2 cut(s) 288, 335
HinfI GANTC 2 cut(s) 36, 98
HpaII CCGG 1 cut(s) 280
Hpy188I TCNGA 1 cut(s) 103
Hpy188III TCNNGA 2 cut(s) 77, 83
HpyAV CCTTC 2 cut(s) 72, 188
HpyCH4III ACNGT 1 cut(s) 276
HpyF10VI GCNNNNNNNGC 1 cut(s) 29
Hsp92II CATG 2 cut(s) 288, 335
Kzo9I GATC 3 cut(s) 79, 171, 213
LmnI GCTCC 1 cut(s) 47
LpnPI CCDG 3 cut(s) 192, 293, 298
Lsp1109I GCAGC 2 cut(s) 296, 301
LweI GCATC 2 cut(s) 128, 162
MalI GATC 3 cut(s) 81, 173, 215
MboI GATC 3 cut(s) 79, 171, 213
MboII GAAGA 1 cut(s) 66
MluCI AATT 1 cut(s) 233
MlyI GAGTC 1 cut(s) 45
MnlI CCTC 6 cut(s) 50, 100, 103, 173, 203, 311
MseI TTAA 1 cut(s) 159
MspI CCGG 1 cut(s) 280
MwoI GCNNNNNNNGC 1 cut(s) 29
NdeII GATC 3 cut(s) 79, 171, 213
NlaIII CATG 2 cut(s) 288, 335
NlaIV GGNNCC 2 cut(s) 12, 229
PfeI GAWTC 1 cut(s) 98
PkrI GCNGC 5 cut(s) 25, 28, 31, 291, 311
PleI GAGTC 1 cut(s) 44
PpsI GAGTC 1 cut(s) 44
PsiI TTATAA 2 cut(s) 132, 340
PspN4I GGNNCC 2 cut(s) 12, 229
PspPI GGNCC 2 cut(s) 10, 59
PsrI GAACNNNNNNTAC 2 cut(s) 211, 243
SaqAI TTAA 1 cut(s) 159
SatI GCNGC 5 cut(s) 24, 27, 30, 290, 310
Sau3AI GATC 3 cut(s) 79, 171, 213
Sau96I GGNCC 2 cut(s) 10, 59
SchI GAGTC 1 cut(s) 45
SetI ASST 3 cut(s) 251, 303, 311
SfaNI GCATC 2 cut(s) 128, 162
SfcI CTRYAG 1 cut(s) 304
Sse9I AATT 1 cut(s) 233
SsiI CCGC 7 cut(s) 23, 26, 29, 32, 45, 89, 151
StyI CCWWGG 2 cut(s) 175, 267
TaaI ACNGT 1 cut(s) 276
TaqI TCGA 2 cut(s) 84, 96
TasI AATT 1 cut(s) 233
TauI GCSGC 3 cut(s) 26, 29, 32
TfiI GAWTC 1 cut(s) 98
Tru1I TTAA 1 cut(s) 159
Tru9I TTAA 1 cut(s) 159
TscAI CASTG 2 cut(s) 196, 281
TseI GCWGC 2 cut(s) 289, 309
TspDTI ATGAA 1 cut(s) 17
TspRI CASTG 2 cut(s) 196, 281
XapI RAATTY 1 cut(s) 233
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.