Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0001852.1

Orthogroup ID

OG0022658

Physical Location & Seq

Genomic Coordinates Reverse (-)

75513 .. 77721

Gene Structure 2209 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0001852.1_g000013.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 1023 bp

atggcttcactttttgcctggaaattctaccaatacagaaacaaagcagcatttgaagtcatcggctattgcttgccagtagccgaaggagctggaggaactttgaagcttaacatggccctcatccttttacctgtttgtcgtaacacactgacatggcttcgatcaacacaagctaggtccttcattccctttgatgacaacattaatttccacaagatgattgcatttgctatagcaattggaataattgttcatgctgggaaccatgtggcatgtgactttcctcgtctagtaaactcatctgcggaagaatttgagccaatatcctctgatttccatggcaaaaacccgacgtacaaattcttattcactggaccagaaggcttgactggaattctgatggtgatttttatggccatctcattcacactagcagcgagtcactttcgaaggaacatggtgaggcttcctgcccccttgaacaaactgactgggtttaatgcgttctggtattcttatcatctgctaggtctggtctacgttttgctactcatccatggaagcggcacccattttccatcacctcagcacctggggatgagcatcttgagtgttcatatccgaacagttggagactggacgcaagaattgaagcaagccatttctgagggagatcattcattatccttggttcatcaaacattcaatctagtctacagcaactatgatgtcatactccttgtgggtcttggcattggagctgccccttttgatcagattgaacttcacaactaccgtacgagtgtctacgaagagggtgatgcaaggtcaactctaatcaccatggtccaagctctcaaccatgccaaacatggagttgacatcctatctggcaccagagtaatgactcattttgcaagacctaattggaaagaagtgtttaccaagatagcttccaagcatccattttcgacagtgggcgaagataatctaccagaagtccagaactatacacgttaa

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

ko04016 ko04626 map04016 map04626

Pfam Domains

Protein Families

FAD_binding_8 Ferric_reduct NADPH_Ox NAD_binding_6

Protein Analysis

340

Amino Acids

38.06

Weight (kDa)

7.84

Isoelectric Point (pI)

40.68

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0022658)

Species	Orthologous Gene IDs
rosa_chinensis	RchiOBHm_Chr2g0103591
rosa_multiflora	Rmu_sc0001530.1_g000017 Rmu_sc0001852.1_g000013
rosa_rugosa	Rorug02G0116200

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccB1I	GGYRCC	2 cut(s)	569, 896
AccI	GTMKAC	3 cut(s)	540, 717, 810
AciI	CCGC	2 cut(s)	308, 567
AcoI	YGGCCR	1 cut(s)	417
AcsI	RAATTY	4 cut(s)	23, 314, 362, 396
AfaI	GTAC	2 cut(s)	359, 802
AflIII	ACRYGT	1 cut(s)	1016
AgsI	TTSAA	6 cut(s)	56, 106, 484, 655, 709, 785
AjnI	CCWGG	2 cut(s)	17, 594
AloI	GAACNNNNNNTCC	2 cut(s)	237, 269
AluBI	AGCT	6 cut(s)	92, 109, 176, 764, 857, 956
AluI	AGCT	6 cut(s)	92, 109, 176, 764, 857, 956
Alw26I	GTCTC	1 cut(s)	630
AlwNI	CAGNNNCTG	1 cut(s)	595
AoxI	GGCC	2 cut(s)	117, 417
ApeKI	GCWGC	3 cut(s)	47, 437, 764
ApoI	RAATTY	4 cut(s)	23, 314, 362, 396
AseI	ATTAAT	1 cut(s)	207
AspS9I	GGNCC	4 cut(s)	118, 180, 377, 850
AsuHPI	GGTGA	5 cut(s)	418, 475, 576, 833, 835
AsuII	TTCGAA	1 cut(s)	451
AvaII	GGWCC	3 cut(s)	180, 377, 850
BalI	TGGCCA	1 cut(s)	419
BanI	GGYRCC	2 cut(s)	569, 896
BarI	GAAGNNNNNNTAC	2 cut(s)	978, 1010
BbvCI	CCTCAGC	1 cut(s)	588
BbvI	GCAGC	3 cut(s)	59, 449, 751
BccI	CCATC	3 cut(s)	397, 428, 589
BciT130I	CCWGG	2 cut(s)	19, 596
BclI	TGATCA	1 cut(s)	775
BcoDI	GTCTC	1 cut(s)	630
BfaI	CTAG	5 cut(s)	177, 293, 434, 530, 713
BfmI	CTRYAG	2 cut(s)	234, 718
BisI	GCNGC	4 cut(s)	48, 438, 568, 765
BlsI	GCNGC	4 cut(s)	49, 439, 569, 766
Bme1390I	CCNGG	2 cut(s)	19, 596
Bme18I	GGWCC	3 cut(s)	180, 377, 850
BmgT120I	GGNCC	4 cut(s)	118, 180, 377, 850
BmiI	GGNNCC	3 cut(s)	266, 571, 898
BmrFI	CCNGG	2 cut(s)	19, 596
BmrI	ACTGGG	1 cut(s)	504
BmsI	GCATC	3 cut(s)	615, 814, 973
BmuI	ACTGGG	1 cut(s)	504
BpmI	CTGGAG	1 cut(s)	114
Bpu10I	CCTNAGC	1 cut(s)	588
Bpu14I	TTCGAA	1 cut(s)	451
BpuEI	CTTGAG	1 cut(s)	631
BsaBI	GATNNNNATC	1 cut(s)	605
BsaJI	CCNNGG	5 cut(s)	340, 559, 595, 690, 846
Bse1I	ACTGG	5 cut(s)	77, 379, 397, 499, 644
Bse8I	GATNNNNATC	1 cut(s)	605
BseBI	CCWGG	2 cut(s)	19, 596
BseDI	CCNNGG	5 cut(s)	340, 559, 595, 690, 846
BseGI	GGATG	5 cut(s)	123, 555, 606, 885, 964
BseJI	GATNNNNATC	1 cut(s)	605
BseMII	CTCAG	2 cut(s)	602, 660
BseNI	ACTGG	5 cut(s)	77, 379, 397, 499, 644
BseXI	GCAGC	3 cut(s)	59, 449, 751
BseYI	CCCAGC	1 cut(s)	260
BshFI	GGCC	2 cut(s)	119, 419
BshNI	GGYRCC	2 cut(s)	569, 896
BsiWI	CGTACG	1 cut(s)	800
BsmAI	GTCTC	1 cut(s)	630
BsnI	GGCC	2 cut(s)	119, 419
Bsp119I	TTCGAA	1 cut(s)	451
Bsp143I	GATC	3 cut(s)	164, 676, 775
Bsp19I	CCATGG	3 cut(s)	340, 559, 846
BspACI	CCGC	2 cut(s)	308, 567
BspANI	GGCC	2 cut(s)	119, 419
BspCNI	CTCAG	2 cut(s)	601, 661
BspLI	GGNNCC	3 cut(s)	266, 571, 898
BspT104I	TTCGAA	1 cut(s)	451
BspT107I	GGYRCC	2 cut(s)	569, 896
BsrI	ACTGG	5 cut(s)	77, 379, 397, 499, 644
BssECI	CCNNGG	5 cut(s)	340, 559, 595, 690, 846
BssMI	GATC	3 cut(s)	164, 676, 775
BssT1I	CCWWGG	4 cut(s)	340, 559, 690, 846
Bst2UI	CCWGG	2 cut(s)	19, 596
Bst4CI	ACNGT	3 cut(s)	631, 800, 979
Bst6I	CTCTTC	1 cut(s)	810
BstBI	TTCGAA	1 cut(s)	451
BstC8I	GCNNGC	2 cut(s)	74, 660
BstDEI	CTNAG	2 cut(s)	588, 669
BstDSI	CCRYGG	3 cut(s)	340, 559, 846
BstF5I	GGATG	5 cut(s)	123, 555, 606, 885, 964
BstKTI	GATC	3 cut(s)	167, 679, 778
BstMAI	GTCTC	1 cut(s)	630
BstMBI	GATC	3 cut(s)	164, 676, 775
BstMWI	GCNNNNNNNGC	1 cut(s)	89
BstNI	CCWGG	2 cut(s)	19, 596
BstNSI	RCATGY	1 cut(s)	279
BstSCI	CCNGG	2 cut(s)	17, 594
BstSFI	CTRYAG	2 cut(s)	234, 718
BstV1I	GCAGC	3 cut(s)	59, 449, 751
BsuRI	GGCC	2 cut(s)	119, 419
BtgI	CCRYGG	3 cut(s)	340, 559, 846
BtsCI	GGATG	5 cut(s)	123, 555, 606, 885, 964
BtsIMutI	CAGTG	3 cut(s)	149, 372, 984
Cac8I	GCNNGC	2 cut(s)	74, 660
CaiI	CAGNNNCTG	1 cut(s)	595
Cfr13I	GGNCC	4 cut(s)	118, 180, 377, 850
CseI	GACGC	1 cut(s)	652
Csp6I	GTAC	2 cut(s)	358, 801
CviQI	GTAC	2 cut(s)	358, 801
DdeI	CTNAG	2 cut(s)	588, 669
DpnI	GATC	3 cut(s)	166, 678, 777
DpnII	GATC	3 cut(s)	164, 676, 775
EaeI	YGGCCR	1 cut(s)	417
Eam1104I	CTCTTC	1 cut(s)	810
EarI	CTCTTC	1 cut(s)	810
Eco130I	CCWWGG	4 cut(s)	340, 559, 690, 846
Eco47I	GGWCC	3 cut(s)	180, 377, 850
EcoO109I	RGGNCCY	1 cut(s)	180
EcoRI	GAATTC	1 cut(s)	396
EcoRII	CCWGG	2 cut(s)	17, 594
EcoT14I	CCWWGG	4 cut(s)	340, 559, 690, 846
ErhI	CCWWGG	4 cut(s)	340, 559, 690, 846
FbaI	TGATCA	1 cut(s)	775
FblI	GTMKAC	3 cut(s)	540, 717, 810
Fnu4HI	GCNGC	4 cut(s)	48, 438, 568, 765
FokI	GGATG	5 cut(s)	110, 542, 613, 872, 951
Fsp4HI	GCNGC	4 cut(s)	48, 438, 568, 765
FspBI	CTAG	5 cut(s)	177, 293, 434, 530, 713
GluI	GCNGC	4 cut(s)	48, 438, 568, 765
GsaI	CCCAGC	1 cut(s)	264
GsuI	CTGGAG	1 cut(s)	114
HaeIII	GGCC	2 cut(s)	119, 419
HgaI	GACGC	1 cut(s)	652
HincII	GTYRAC	2 cut(s)	834, 883
HindII	GTYRAC	2 cut(s)	834, 883
HindIII	AAGCTT	1 cut(s)	107
HinfI	GANTC	2 cut(s)	442, 910
HphI	GGTGA	5 cut(s)	418, 475, 576, 833, 835
Hpy166II	GTNNAC	7 cut(s)	298, 541, 718, 811, 834, 883, 945
Hpy188I	TCNGA	5 cut(s)	334, 402, 626, 670, 780
Hpy188III	TCNNGA	2 cut(s)	610, 1006
Hpy8I	GTNNAC	7 cut(s)	298, 541, 718, 811, 834, 883, 945
Hpy99I	CGWCG	1 cut(s)	358
HpyAV	CCTTC	4 cut(s)	80, 193, 377, 447
HpyCH4III	ACNGT	3 cut(s)	631, 800, 979
HpyCH4IV	ACGT	3 cut(s)	356, 543, 1018
HpyCH4V	TGCA	3 cut(s)	227, 827, 920
HpyF10VI	GCNNNNNNNGC	1 cut(s)	89
HpyF3I	CTNAG	2 cut(s)	588, 669
HpySE526I	ACGT	3 cut(s)	356, 543, 1018
Ksp22I	TGATCA	1 cut(s)	775
Kzo9I	GATC	3 cut(s)	164, 676, 775
LmnI	GCTCC	2 cut(s)	89, 761
Lsp1109I	GCAGC	3 cut(s)	59, 449, 751
LweI	GCATC	3 cut(s)	615, 814, 973
MaeI	CTAG	5 cut(s)	177, 293, 434, 530, 713
MaeII	ACGT	3 cut(s)	356, 543, 1018
MaeIII	GTNAC	3 cut(s)	143, 278, 443
MalI	GATC	3 cut(s)	166, 678, 777
MboI	GATC	3 cut(s)	164, 676, 775
MboII	GAAGA	3 cut(s)	323, 827, 998
MfeI	CAATTG	1 cut(s)	240
MlsI	TGGCCA	1 cut(s)	419
MluCI	AATT	9 cut(s)	23, 208, 240, 249, 314, 362, 396, 650, 928
MluNI	TGGCCA	1 cut(s)	419
MlyI	GAGTC	2 cut(s)	451, 904
MmeI	TCCRAC	1 cut(s)	613
MnlI	CCTC	8 cut(s)	89, 131, 297, 340, 459, 597, 664, 811
Mox20I	TGGCCA	1 cut(s)	419
MscI	TGGCCA	1 cut(s)	419
MseI	TTAA	4 cut(s)	111, 207, 501, 1021
MslI	CAYNNNNRTG	1 cut(s)	154
Msp20I	TGGCCA	1 cut(s)	419
MspR9I	CCNGG	2 cut(s)	19, 596
MunI	CAATTG	1 cut(s)	240
MvaI	CCWGG	2 cut(s)	19, 596
MwoI	GCNNNNNNNGC	1 cut(s)	89
NcoI	CCATGG	3 cut(s)	340, 559, 846
NdeII	GATC	3 cut(s)	164, 676, 775
NlaIV	GGNNCC	3 cut(s)	266, 571, 898
NmuCI	GTSAC	2 cut(s)	278, 443
NspI	RCATGY	1 cut(s)	279
NspV	TTCGAA	1 cut(s)	451
Pfl23II	CGTACG	1 cut(s)	800
PkrI	GCNGC	4 cut(s)	49, 439, 569, 766
PleI	GAGTC	2 cut(s)	450, 904
PpsI	GAGTC	2 cut(s)	450, 904
PpuMI	RGGWCCY	1 cut(s)	180
PshBI	ATTAAT	1 cut(s)	207
Psp5II	RGGWCCY	1 cut(s)	180
Psp6I	CCWGG	2 cut(s)	17, 594
PspFI	CCCAGC	1 cut(s)	260
PspGI	CCWGG	2 cut(s)	17, 594
PspLI	CGTACG	1 cut(s)	800
PspN4I	GGNNCC	3 cut(s)	266, 571, 898
PspPI	GGNCC	4 cut(s)	118, 180, 377, 850
PspPPI	RGGWCCY	1 cut(s)	180
PstNI	CAGNNNCTG	1 cut(s)	595
RsaI	GTAC	2 cut(s)	359, 802
RsaNI	GTAC	2 cut(s)	358, 801
RseI	CAYNNNNRTG	1 cut(s)	154
SaqAI	TTAA	4 cut(s)	111, 207, 501, 1021
SatI	GCNGC	4 cut(s)	48, 438, 568, 765
Sau3AI	GATC	3 cut(s)	164, 676, 775
Sau96I	GGNCC	4 cut(s)	118, 180, 377, 850
SchI	GAGTC	2 cut(s)	451, 904
ScrFI	CCNGG	2 cut(s)	19, 596
SfaNI	GCATC	3 cut(s)	615, 814, 973
SfcI	CTRYAG	2 cut(s)	234, 718
SfuI	TTCGAA	1 cut(s)	451
SinI	GGWCC	3 cut(s)	180, 377, 850
SmiMI	CAYNNNNRTG	1 cut(s)	154
SmlI	CTYRAG	1 cut(s)	610
SmoI	CTYRAG	1 cut(s)	610
Sse9I	AATT	9 cut(s)	23, 208, 240, 249, 314, 362, 396, 650, 928
SsiI	CCGC	2 cut(s)	308, 567
SspMI	CTAG	5 cut(s)	177, 293, 434, 530, 713
StyD4I	CCNGG	2 cut(s)	17, 594
StyI	CCWWGG	4 cut(s)	340, 559, 690, 846
TaaI	ACNGT	3 cut(s)	631, 800, 979
TaiI	ACGT	3 cut(s)	359, 546, 1021
TaqI	TCGA	3 cut(s)	163, 451, 974
TasI	AATT	9 cut(s)	23, 208, 240, 249, 314, 362, 396, 650, 928
TauI	GCSGC	1 cut(s)	570
Tru1I	TTAA	4 cut(s)	111, 207, 501, 1021
Tru9I	TTAA	4 cut(s)	111, 207, 501, 1021
TscAI	CASTG	3 cut(s)	156, 379, 984
TseFI	GTSAC	2 cut(s)	278, 443
TseI	GCWGC	3 cut(s)	47, 437, 764
Tsp45I	GTSAC	2 cut(s)	278, 443
TspDTI	ATGAA	5 cut(s)	175, 245, 608, 672, 686
TspRI	CASTG	3 cut(s)	156, 379, 984
VpaK11BI	GGWCC	3 cut(s)	180, 377, 850
VspI	ATTAAT	1 cut(s)	207
XapI	RAATTY	4 cut(s)	23, 314, 362, 396
XceI	RCATGY	1 cut(s)	279
XcmI	CCANNNNNNNNNTGG	1 cut(s)	872
XmiI	GTMKAC	3 cut(s)	540, 717, 810
XspI	CTAG	5 cut(s)	177, 293, 434, 530, 713

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.