Rmu_sc0001998.1_g000044

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0001998.1
OG0025460
Physical Location & Seq
Reverse (-)
175534 .. 175851
318 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0001998.1_g000044.1.cds

Sequence Viewer

Length: 318 bp
atgcgaacacctacaaagcatgctcaagcagttatcttgatgcgacgccatatggacaaggcactcagattggagtatatgtcaatcaaggatgcaagagagctatgggtagcgctagatgagcgctttggcaatgtccaagattccctcctccctaacttgaaggttcaatggaacgatctgcgctttgctgatttcaagtctgttgctgaatataattcagaaactcttcgcctacagtccatgttgaggttttgtggacaacctgtcacagagcaagagctaattgagaaaactttctccaccttccccgtttaa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Retrotran_gag_2 zf-CCHC

Protein Analysis

105

Amino Acids

12.39

Weight (kDa)

7.9

Isoelectric Point (pI)

62.11

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0025460)

Species Orthologous Gene IDs
rosa_multiflora Rmu_sc0000744.1_g000113 Rmu_sc0001998.1_g000044 Rmu_ssc0000237.1_g000007

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcyI GRCGYC 1 cut(s) 46
AfeI AGCGCT 2 cut(s) 114, 125
AfiI CCNNNNNNNGG 1 cut(s) 249
AgsI TTSAA 3 cut(s) 163, 170, 199
AhdI GACNNNNNGTC 1 cut(s) 266
AluBI AGCT 2 cut(s) 103, 283
AluI AGCT 2 cut(s) 103, 283
Aor51HI AGCGCT 2 cut(s) 114, 125
Asp700I GAANNNNTTC 2 cut(s) 228, 296
AspLEI GCGC 3 cut(s) 115, 126, 186
BfaI CTAG 1 cut(s) 116
BfmI CTRYAG 1 cut(s) 236
BfoI RGCGCY 2 cut(s) 116, 127
BmeRI GACNNNNNGTC 1 cut(s) 266
BmsI GCATC 2 cut(s) 30, 82
BpuEI CTTGAG 1 cut(s) 9
BsaHI GRCGYC 1 cut(s) 46
BsaXI ACNNNNNCTCC 2 cut(s) 65, 95
Bsc4I CCNNNNNNNGG 1 cut(s) 249
Bse3DI GCAATG 1 cut(s) 139
BseGI GGATG 1 cut(s) 97
BseLI CCNNNNNNNGG 1 cut(s) 249
BseMI GCAATG 1 cut(s) 139
BseMII CTCAG 1 cut(s) 79
BseRI GAGGAG 1 cut(s) 140
BslI CCNNNNNNNGG 1 cut(s) 249
Bsp143I GATC 1 cut(s) 178
BspCNI CTCAG 1 cut(s) 78
BsrDI GCAATG 1 cut(s) 139
BssMI GATC 1 cut(s) 178
BssNI GRCGYC 1 cut(s) 46
Bst4CI ACNGT 1 cut(s) 240
Bst6I CTCTTC 1 cut(s) 234
BstACI GRCGYC 1 cut(s) 46
BstC8I GCNNGC 1 cut(s) 21
BstDEI CTNAG 1 cut(s) 65
BstF5I GGATG 1 cut(s) 97
BstH2I RGCGCY 2 cut(s) 116, 127
BstHHI GCGC 3 cut(s) 115, 126, 186
BstKTI GATC 1 cut(s) 181
BstMBI GATC 1 cut(s) 178
BstMWI GCNNNNNNNGC 1 cut(s) 121
BstNSI RCATGY 1 cut(s) 23
BstSFI CTRYAG 1 cut(s) 236
BtsCI GGATG 1 cut(s) 97
Cac8I GCNNGC 1 cut(s) 21
CfoI GCGC 3 cut(s) 115, 126, 186
CseI GACGC 1 cut(s) 54
CviAII CATG 2 cut(s) 20, 244
CviJI RGCY 2 cut(s) 103, 283
CviKI_1 RGCY 2 cut(s) 103, 283
DdeI CTNAG 1 cut(s) 65
DpnI GATC 1 cut(s) 180
DpnII GATC 1 cut(s) 178
DriI GACNNNNNGTC 1 cut(s) 266
Eam1104I CTCTTC 1 cut(s) 234
Eam1105I GACNNNNNGTC 1 cut(s) 266
EarI CTCTTC 1 cut(s) 234
Eco47III AGCGCT 2 cut(s) 114, 125
FaeI CATG 2 cut(s) 23, 247
FaiI YATR 8 cut(s) 21, 51, 53, 78, 80, 106, 216, 245
FatI CATG 2 cut(s) 19, 243
FauNDI CATATG 1 cut(s) 51
FokI GGATG 1 cut(s) 104
FspBI CTAG 1 cut(s) 116
GlaI GCGC 3 cut(s) 114, 125, 185
HaeII RGCGCY 2 cut(s) 116, 127
HgaI GACGC 1 cut(s) 54
HhaI GCGC 3 cut(s) 115, 126, 186
Hin1I GRCGYC 1 cut(s) 46
Hin1II CATG 2 cut(s) 23, 247
Hin6I GCGC 3 cut(s) 113, 124, 184
HinP1I GCGC 3 cut(s) 113, 124, 184
HinfI GANTC 1 cut(s) 143
Hpy166II GTNNAC 1 cut(s) 260
Hpy188I TCNGA 2 cut(s) 68, 223
Hpy188III TCNNGA 1 cut(s) 37
Hpy8I GTNNAC 1 cut(s) 260
Hpy99I CGWCG 1 cut(s) 48
HpyAV CCTTC 2 cut(s) 157, 316
HpyCH4III ACNGT 1 cut(s) 240
HpyCH4V TGCA 1 cut(s) 95
HpyF10VI GCNNNNNNNGC 1 cut(s) 121
HpyF3I CTNAG 1 cut(s) 65
Hsp92I GRCGYC 1 cut(s) 46
Hsp92II CATG 2 cut(s) 23, 247
HspAI GCGC 3 cut(s) 113, 124, 184
Kzo9I GATC 1 cut(s) 178
LpnPI CCDG 1 cut(s) 279
LweI GCATC 2 cut(s) 30, 82
MaeI CTAG 1 cut(s) 116
MaeIII GTNAC 1 cut(s) 268
MalI GATC 1 cut(s) 180
MboI GATC 1 cut(s) 178
MboII GAAGA 1 cut(s) 221
MluCI AATT 2 cut(s) 217, 285
MnlI CCTC 3 cut(s) 158, 161, 243
MroXI GAANNNNTTC 2 cut(s) 228, 296
MseI TTAA 1 cut(s) 316
MwoI GCNNNNNNNGC 1 cut(s) 121
NdeI CATATG 1 cut(s) 51
NdeII GATC 1 cut(s) 178
NlaIII CATG 2 cut(s) 23, 247
NmuCI GTSAC 1 cut(s) 268
NspI RCATGY 1 cut(s) 23
PaeI GCATGC 1 cut(s) 23
PdmI GAANNNNTTC 2 cut(s) 228, 296
PfeI GAWTC 1 cut(s) 143
SaqAI TTAA 1 cut(s) 316
Sau3AI GATC 1 cut(s) 178
SetI ASST 7 cut(s) 13, 105, 168, 254, 268, 285, 308
SfaNI GCATC 2 cut(s) 30, 82
SfcI CTRYAG 1 cut(s) 236
SmlI CTYRAG 1 cut(s) 24
SmoI CTYRAG 1 cut(s) 24
SphI GCATGC 1 cut(s) 23
Sse9I AATT 2 cut(s) 217, 285
SspMI CTAG 1 cut(s) 116
TaaI ACNGT 1 cut(s) 240
TasI AATT 2 cut(s) 217, 285
TfiI GAWTC 1 cut(s) 143
Tru1I TTAA 1 cut(s) 316
Tru9I TTAA 1 cut(s) 316
TseFI GTSAC 1 cut(s) 268
Tsp45I GTSAC 1 cut(s) 268
XceI RCATGY 1 cut(s) 23
XmnI GAANNNNTTC 2 cut(s) 228, 296
XspI CTAG 1 cut(s) 116
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.