Rmu_sc0002005.1_g000012

Belongs to the iron ascorbate-dependent oxidoreductase family

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0002005.1
OG0025525
Physical Location & Seq
Reverse (-)
61068 .. 63833
2766 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 408 bp
atggtatcatcaaaaccaggaagcagctttggcccctctcatcatgactcaggagtcagtagtattgagaaactcatcaccgatgattcagtgatcgaagtcccccaaaactatgttatctcagatcaggagtctccgattctgagtgatgggatttataaaagtattgagcacagagtaattgtgaacccagagaaagaaaggatttcaattgctatgttcttcatgcccaaacttgagtcagaaattggacctgtgaccgccctgagagatcctcagaagccaccatctcctgggaaaataggaatggcaaaatttgtcgagaattacttcgctcataatcttaatggaaaaacacccttggagcgaatcagaacaaaagatggtgaagagaatactactgcatga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
2OG-FeII_Oxy DIOX_N

Protein Analysis

135

Amino Acids

14.88

Weight (kDa)

5.55

Isoelectric Point (pI)

53.08

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
2OG-FeII_Oxy PF03171 25 - 77 1.1e-07 2OG-Fe(II) oxygenase superfamily
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0025525)

Species Orthologous Gene IDs
rosa_multiflora Rmu_co8169706.1_g000001 Rmu_sc0002005.1_g000012
rosa_samantha Rh2CG339300

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 159
AasI GACNNNNNNGTC 1 cut(s) 53
AccB7I CCANNNNNTGG 1 cut(s) 293
AciI CCGC 1 cut(s) 261
AclWI GGATC 1 cut(s) 266
AcsI RAATTY 1 cut(s) 314
AfiI CCNNNNNNNGG 1 cut(s) 293
AgsI TTSAA 1 cut(s) 210
AjnI CCWGG 2 cut(s) 16, 292
AluBI AGCT 1 cut(s) 27
AluI AGCT 1 cut(s) 27
Alw21I GWGCWC 1 cut(s) 174
Alw26I GTCTC 1 cut(s) 138
AlwI GGATC 1 cut(s) 266
AoxI GGCC 1 cut(s) 31
ApeKI GCWGC 1 cut(s) 24
ApoI RAATTY 1 cut(s) 314
Asp700I GAANNNNTTC 1 cut(s) 329
AspS9I GGNCC 2 cut(s) 32, 251
AsuHPI GGTGA 2 cut(s) 70, 398
AvaII GGWCC 1 cut(s) 251
Bbv12I GWGCWC 1 cut(s) 174
BbvI GCAGC 1 cut(s) 36
BccI CCATC 3 cut(s) 143, 295, 377
BciT130I CCWGG 2 cut(s) 18, 294
BcoDI GTCTC 1 cut(s) 138
BisI GCNGC 1 cut(s) 25
BlsI GCNGC 1 cut(s) 26
Bme1390I CCNGG 2 cut(s) 18, 294
Bme18I GGWCC 1 cut(s) 251
BmgT120I GGNCC 2 cut(s) 32, 251
BmiI GGNNCC 1 cut(s) 34
BmrFI CCNGG 2 cut(s) 18, 294
BplI GAGNNNNNCTC 2 cut(s) 259, 291
BpuEI CTTGAG 1 cut(s) 257
BsaJI CCNNGG 2 cut(s) 293, 360
Bsc4I CCNNNNNNNGG 1 cut(s) 293
BseBI CCWGG 2 cut(s) 18, 294
BseDI CCNNGG 2 cut(s) 293, 360
BseLI CCNNNNNNNGG 1 cut(s) 293
BseMII CTCAG 5 cut(s) 63, 134, 135, 257, 290
BseXI GCAGC 1 cut(s) 36
BshFI GGCC 1 cut(s) 33
BsiHKAI GWGCWC 1 cut(s) 174
BslFI GGGAC 1 cut(s) 86
BslI CCNNNNNNNGG 1 cut(s) 293
BsmAI GTCTC 1 cut(s) 138
BsmFI GGGAC 1 cut(s) 86
BsnI GGCC 1 cut(s) 33
Bsp1286I GDGCHC 1 cut(s) 174
Bsp143I GATC 3 cut(s) 93, 124, 271
BspACI CCGC 1 cut(s) 261
BspANI GGCC 1 cut(s) 33
BspCNI CTCAG 5 cut(s) 62, 134, 135, 258, 289
BspHI TCATGA 1 cut(s) 43
BspLI GGNNCC 1 cut(s) 34
BspPI GGATC 1 cut(s) 266
BssECI CCNNGG 2 cut(s) 293, 360
BssMI GATC 3 cut(s) 93, 124, 271
BssT1I CCWWGG 1 cut(s) 360
Bst2UI CCWGG 2 cut(s) 18, 294
Bst6I CTCTTC 1 cut(s) 384
BstDEI CTNAG 5 cut(s) 49, 121, 143, 266, 276
BstKTI GATC 3 cut(s) 96, 127, 274
BstMAI GTCTC 1 cut(s) 138
BstMBI GATC 3 cut(s) 93, 124, 271
BstMWI GCNNNNNNNGC 1 cut(s) 30
BstNI CCWGG 2 cut(s) 18, 294
BstSCI CCNGG 2 cut(s) 16, 292
BstV1I GCAGC 1 cut(s) 36
BstX2I RGATCY 1 cut(s) 271
BstYI RGATCY 1 cut(s) 271
BsuRI GGCC 1 cut(s) 33
BtsIMutI CAGTG 1 cut(s) 96
CciI TCATGA 1 cut(s) 43
Cfr13I GGNCC 2 cut(s) 32, 251
CviAII CATG 3 cut(s) 44, 226, 405
CviJI RGCY 3 cut(s) 27, 33, 283
CviKI_1 RGCY 3 cut(s) 27, 33, 283
DdeI CTNAG 5 cut(s) 49, 121, 143, 266, 276
DpnI GATC 3 cut(s) 95, 126, 273
DpnII GATC 3 cut(s) 93, 124, 271
DrdI GACNNNNNNGTC 1 cut(s) 53
DseDI GACNNNNNNGTC 1 cut(s) 53
Eam1104I CTCTTC 1 cut(s) 384
EarI CTCTTC 1 cut(s) 384
Eco130I CCWWGG 1 cut(s) 360
Eco47I GGWCC 1 cut(s) 251
EcoRII CCWGG 2 cut(s) 16, 292
EcoT14I CCWWGG 1 cut(s) 360
ErhI CCWWGG 1 cut(s) 360
FaeI CATG 3 cut(s) 47, 229, 408
FaiI YATR 7 cut(s) 45, 114, 159, 218, 227, 339, 406
FaqI GGGAC 1 cut(s) 86
FatI CATG 3 cut(s) 43, 225, 404
Fnu4HI GCNGC 1 cut(s) 25
Fsp4HI GCNGC 1 cut(s) 25
GluI GCNGC 1 cut(s) 25
HaeIII GGCC 1 cut(s) 33
Hin1II CATG 3 cut(s) 47, 229, 408
HinfI GANTC 7 cut(s) 47, 54, 86, 131, 139, 239, 369
HphI GGTGA 2 cut(s) 70, 398
Hpy166II GTNNAC 1 cut(s) 187
Hpy188I TCNGA 6 cut(s) 124, 138, 144, 244, 279, 374
Hpy188III TCNNGA 4 cut(s) 44, 51, 128, 322
Hpy8I GTNNAC 1 cut(s) 187
HpyCH4V TGCA 1 cut(s) 404
HpyF10VI GCNNNNNNNGC 1 cut(s) 30
HpyF3I CTNAG 5 cut(s) 49, 121, 143, 266, 276
Hsp92II CATG 3 cut(s) 47, 229, 408
Kzo9I GATC 3 cut(s) 93, 124, 271
LmnI GCTCC 1 cut(s) 364
LpnPI CCDG 9 cut(s) 3, 30, 36, 113, 204, 267, 278, 279, 306
Lsp1109I GCAGC 1 cut(s) 36
MaeIII GTNAC 1 cut(s) 256
MalI GATC 3 cut(s) 95, 126, 273
MboI GATC 3 cut(s) 93, 124, 271
MboII GAAGA 2 cut(s) 214, 401
MfeI CAATTG 1 cut(s) 210
MflI RGATCY 1 cut(s) 271
MhlI GDGCHC 1 cut(s) 174
MluCI AATT 5 cut(s) 180, 210, 246, 314, 325
MlyI GAGTC 4 cut(s) 41, 63, 140, 248
MnlI CCTC 2 cut(s) 46, 285
MroXI GAANNNNTTC 1 cut(s) 329
MseI TTAA 1 cut(s) 345
MspR9I CCNGG 2 cut(s) 18, 294
MunI CAATTG 1 cut(s) 210
MvaI CCWGG 2 cut(s) 18, 294
MwoI GCNNNNNNNGC 1 cut(s) 30
NdeII GATC 3 cut(s) 93, 124, 271
NlaIII CATG 3 cut(s) 47, 229, 408
NlaIV GGNNCC 1 cut(s) 34
NmuCI GTSAC 1 cut(s) 256
PagI TCATGA 1 cut(s) 43
PdmI GAANNNNTTC 1 cut(s) 329
PfeI GAWTC 3 cut(s) 86, 139, 369
PflMI CCANNNNNTGG 1 cut(s) 293
PkrI GCNGC 1 cut(s) 26
PleI GAGTC 4 cut(s) 41, 62, 139, 247
PpsI GAGTC 4 cut(s) 41, 62, 139, 247
PsiI TTATAA 1 cut(s) 159
Psp6I CCWGG 2 cut(s) 16, 292
PspGI CCWGG 2 cut(s) 16, 292
PspN4I GGNNCC 1 cut(s) 34
PspPI GGNCC 2 cut(s) 32, 251
PsuI RGATCY 1 cut(s) 271
SaqAI TTAA 1 cut(s) 345
SatI GCNGC 1 cut(s) 25
Sau3AI GATC 3 cut(s) 93, 124, 271
Sau96I GGNCC 2 cut(s) 32, 251
SchI GAGTC 4 cut(s) 41, 63, 140, 248
ScrFI CCNGG 2 cut(s) 18, 294
SduI GDGCHC 1 cut(s) 174
SetI ASST 2 cut(s) 29, 256
SinI GGWCC 1 cut(s) 251
SmlI CTYRAG 1 cut(s) 236
SmoI CTYRAG 1 cut(s) 236
Sse9I AATT 5 cut(s) 180, 210, 246, 314, 325
SsiI CCGC 1 cut(s) 261
StyD4I CCNGG 2 cut(s) 16, 292
StyI CCWWGG 1 cut(s) 360
TaqI TCGA 2 cut(s) 96, 321
TasI AATT 5 cut(s) 180, 210, 246, 314, 325
TfiI GAWTC 3 cut(s) 86, 139, 369
Tru1I TTAA 1 cut(s) 345
Tru9I TTAA 1 cut(s) 345
TscAI CASTG 1 cut(s) 96
TseFI GTSAC 1 cut(s) 256
TseI GCWGC 1 cut(s) 24
Tsp45I GTSAC 1 cut(s) 256
TspDTI ATGAA 1 cut(s) 214
TspRI CASTG 1 cut(s) 96
Van91I CCANNNNNTGG 1 cut(s) 293
VpaK11BI GGWCC 1 cut(s) 251
XapI RAATTY 1 cut(s) 314
XmnI GAANNNNTTC 1 cut(s) 329
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.