Rmu_sc0002028.1_g000004

Ribonuclease H protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0002028.1
OG0023077
Physical Location & Seq
Forward (+)
25006 .. 26315
1310 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 873 bp
atgttgggttgtttccgcttctttaccgaagtttggttgattctctctcgcttactttgcttgatggaggaagttgtcgatagtttttccaggaaattggctttatcggaggcggaagtcaagcaggagtcagatcttggttggatcttgaggggcagtccatggtcctttgagaaggctttggttgctgtagcggttacaaatggcactgaagatccttgcacggtttcattagacactcaatatttctggattcgcatccggggtttacctccactccatatggatgatgaaatggtggttaatacaggccggtgtattggccaggcaattggtctttttgtgagggcagaaaaggctgtggagttagtttttgggggatttcttgcgtatcagagtagggatcaatgtcaaggcttctctgaagaagtgtgtgaaggcttgaggcattatgctacaaaaaaaaagaatgggtggatcatgcaggcccctaatttccctgtggtgggcttcaccaggactagagatgagcgtgatgaggatgctgttgattgcattggagaaggggagtccatggcattggattcggggggtgaagtggaggatacagcaggaggtcaattggcgaaaagaagatgggttttgagtgagttttctgagctttctactggtactggggaggggcttaacacccagccatgtctgaggcacgacccggtactggtcaacccatccttgtcaacatctttgaagagtgtttcaaatgttgacgtttgttttggaaaggagtccaaatccattaaggagtcgaagtcatctgcaactcttagaagtaacaaagaaaatttaaatgtctatcagagaagggtctag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
RVT_1

Protein Analysis

290

Amino Acids

32.28

Weight (kDa)

5.15

Isoelectric Point (pI)

44.09

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0023077)

Species Orthologous Gene IDs
rosa_multiflora Rmu_sc0002028.1_g000004
rosa_samantha Rh5AG358100 Rh5BG370400 Rh5DG384000

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 3 cut(s) 16, 113, 194
AclWI GGATC 4 cut(s) 152, 209, 411, 485
AcoI YGGCCR 1 cut(s) 322
AcsI RAATTY 1 cut(s) 844
AcuI CTGAAG 2 cut(s) 231, 444
AfaI GTAC 2 cut(s) 673, 720
AfiI CCNNNNNNNGG 4 cut(s) 33, 505, 506, 721
AgsI TTSAA 2 cut(s) 751, 762
AjnI CCWGG 3 cut(s) 89, 324, 515
AluBI AGCT 1 cut(s) 661
AluI AGCT 1 cut(s) 661
AlwI GGATC 4 cut(s) 152, 209, 411, 485
AoxI GGCC 3 cut(s) 310, 322, 486
ApoI RAATTY 1 cut(s) 844
ArsI GACNNNNNNTTYG 2 cut(s) 761, 793
AspS9I GGNCC 2 cut(s) 165, 487
AsuC2I CCSGG 2 cut(s) 263, 716
AsuHPI GGTGA 2 cut(s) 505, 605
AvaII GGWCC 1 cut(s) 165
BalI TGGCCA 1 cut(s) 324
BccI CCATC 3 cut(s) 58, 630, 739
BcgI CGANNNNNNTGC 2 cut(s) 567, 601
BciT130I CCWGG 3 cut(s) 91, 326, 517
BciVI GTATCC 1 cut(s) 598
BcnI CCSGG 2 cut(s) 263, 716
BfaI CTAG 2 cut(s) 522, 871
BfmI CTRYAG 1 cut(s) 189
BfuI GTATCC 1 cut(s) 598
BglII AGATCT 1 cut(s) 133
Bme1390I CCNGG 5 cut(s) 91, 263, 326, 517, 716
Bme18I GGWCC 1 cut(s) 165
BmgT120I GGNCC 2 cut(s) 165, 487
BmiI GGNNCC 1 cut(s) 489
BmrFI CCNGG 5 cut(s) 91, 263, 326, 517, 716
BmrI ACTGGG 1 cut(s) 684
BmsI GCATC 2 cut(s) 267, 532
BmuI ACTGGG 1 cut(s) 684
BpuEI CTTGAG 2 cut(s) 169, 463
BpuMI CCSGG 2 cut(s) 263, 716
BsaBI GATNNNNATC 1 cut(s) 257
BsaJI CCNNGG 3 cut(s) 161, 262, 573
BsaXI ACNNNNNCTCC 4 cut(s) 261, 291, 797, 827
Bsc4I CCNNNNNNNGG 4 cut(s) 33, 505, 506, 721
Bse118I RCCGGY 1 cut(s) 312
Bse1I ACTGG 3 cut(s) 673, 679, 726
Bse8I GATNNNNATC 1 cut(s) 257
BseBI CCWGG 3 cut(s) 91, 326, 517
BseDI CCNNGG 3 cut(s) 161, 262, 573
BseGI GGATG 4 cut(s) 258, 292, 547, 731
BseJI GATNNNNATC 1 cut(s) 257
BseLI CCNNNNNNNGG 4 cut(s) 33, 505, 506, 721
BseMII CTCAG 2 cut(s) 648, 695
BseNI ACTGG 3 cut(s) 673, 679, 726
BseYI CCCAGC 1 cut(s) 693
BshFI GGCC 3 cut(s) 312, 324, 488
BsiSI CCGG 3 cut(s) 262, 313, 716
BslI CCNNNNNNNGG 4 cut(s) 33, 505, 506, 721
BsnI GGCC 3 cut(s) 312, 324, 488
Bsp143I GATC 5 cut(s) 133, 144, 214, 403, 477
Bsp19I CCATGG 2 cut(s) 161, 573
BspACI CCGC 3 cut(s) 16, 113, 194
BspANI GGCC 3 cut(s) 312, 324, 488
BspCNI CTCAG 2 cut(s) 649, 696
BspLI GGNNCC 1 cut(s) 489
BspPI GGATC 4 cut(s) 152, 209, 411, 485
BsrFI RCCGGY 1 cut(s) 312
BsrI ACTGG 3 cut(s) 673, 679, 726
BssAI RCCGGY 1 cut(s) 312
BssECI CCNNGG 3 cut(s) 161, 262, 573
BssMI GATC 5 cut(s) 133, 144, 214, 403, 477
BssT1I CCWWGG 2 cut(s) 161, 573
Bst2UI CCWGG 3 cut(s) 91, 326, 517
Bst4CI ACNGT 1 cut(s) 226
Bst6I CTCTTC 1 cut(s) 746
BstC8I GCNNGC 1 cut(s) 486
BstDEI CTNAG 3 cut(s) 657, 704, 827
BstDSI CCRYGG 2 cut(s) 161, 573
BstF5I GGATG 4 cut(s) 258, 292, 547, 731
BstKTI GATC 5 cut(s) 136, 147, 217, 406, 480
BstMBI GATC 5 cut(s) 133, 144, 214, 403, 477
BstMWI GCNNNNNNNGC 3 cut(s) 57, 185, 356
BstNI CCWGG 3 cut(s) 91, 326, 517
BstSCI CCNGG 5 cut(s) 89, 261, 324, 515, 714
BstSFI CTRYAG 1 cut(s) 189
BstX2I RGATCY 3 cut(s) 133, 144, 214
BstXI CCANNNNNNTGG 3 cut(s) 97, 332, 580
BstYI RGATCY 3 cut(s) 133, 144, 214
BsuI GTATCC 1 cut(s) 598
BsuRI GGCC 3 cut(s) 312, 324, 488
BtgI CCRYGG 2 cut(s) 161, 573
BtsCI GGATG 4 cut(s) 258, 292, 547, 731
BtsIMutI CAGTG 1 cut(s) 207
Cac8I GCNNGC 1 cut(s) 486
Cfr10I RCCGGY 1 cut(s) 312
Cfr13I GGNCC 2 cut(s) 165, 487
Csp6I GTAC 2 cut(s) 672, 719
CviAII CATG 4 cut(s) 162, 481, 574, 699
CviQI GTAC 2 cut(s) 672, 719
DdeI CTNAG 3 cut(s) 657, 704, 827
DpnI GATC 5 cut(s) 135, 146, 216, 405, 479
DpnII GATC 5 cut(s) 133, 144, 214, 403, 477
DraI TTTAAA 1 cut(s) 849
EaeI YGGCCR 1 cut(s) 322
Eam1104I CTCTTC 1 cut(s) 746
EarI CTCTTC 1 cut(s) 746
EciI GGCGGA 1 cut(s) 128
Eco130I CCWWGG 2 cut(s) 161, 573
Eco47I GGWCC 1 cut(s) 165
Eco57I CTGAAG 2 cut(s) 231, 444
EcoO109I RGGNCCY 1 cut(s) 487
EcoRII CCWGG 3 cut(s) 89, 324, 515
EcoT14I CCWWGG 2 cut(s) 161, 573
ErhI CCWWGG 2 cut(s) 161, 573
FaeI CATG 4 cut(s) 165, 484, 577, 702
FaiI YATR 7 cut(s) 163, 282, 284, 453, 482, 575, 700
FatI CATG 4 cut(s) 161, 480, 573, 698
FauNDI CATATG 1 cut(s) 282
FokI GGATG 4 cut(s) 245, 299, 554, 718
FspBI CTAG 2 cut(s) 522, 871
GsaI CCCAGC 1 cut(s) 697
HaeIII GGCC 3 cut(s) 312, 324, 488
HapII CCGG 3 cut(s) 262, 313, 716
Hin1II CATG 4 cut(s) 165, 484, 577, 702
HincII GTYRAC 3 cut(s) 727, 741, 769
HindII GTYRAC 3 cut(s) 727, 741, 769
HinfI GANTC 7 cut(s) 40, 128, 253, 569, 584, 788, 806
HpaII CCGG 3 cut(s) 262, 313, 716
HphI GGTGA 2 cut(s) 505, 605
Hpy166II GTNNAC 4 cut(s) 269, 727, 741, 769
Hpy188I TCNGA 7 cut(s) 109, 133, 396, 424, 658, 705, 861
Hpy188III TCNNGA 2 cut(s) 148, 250
Hpy8I GTNNAC 4 cut(s) 269, 727, 741, 769
HpyAV CCTTC 4 cut(s) 169, 431, 557, 858
HpyCH4III ACNGT 1 cut(s) 226
HpyCH4IV ACGT 1 cut(s) 771
HpyCH4V TGCA 4 cut(s) 222, 484, 555, 821
HpyF10VI GCNNNNNNNGC 3 cut(s) 57, 185, 356
HpyF3I CTNAG 3 cut(s) 657, 704, 827
HpySE526I ACGT 1 cut(s) 771
Hsp92II CATG 4 cut(s) 165, 484, 577, 702
Kzo9I GATC 5 cut(s) 133, 144, 214, 403, 477
LweI GCATC 2 cut(s) 267, 532
MaeI CTAG 2 cut(s) 522, 871
MaeII ACGT 1 cut(s) 771
MaeIII GTNAC 2 cut(s) 196, 833
MalI GATC 5 cut(s) 135, 146, 216, 405, 479
MboI GATC 5 cut(s) 133, 144, 214, 403, 477
MboII GAAGA 4 cut(s) 224, 437, 645, 763
MfeI CAATTG 2 cut(s) 330, 620
MflI RGATCY 3 cut(s) 133, 144, 214
MlsI TGGCCA 1 cut(s) 324
MluCI AATT 5 cut(s) 95, 330, 493, 620, 844
MluNI TGGCCA 1 cut(s) 324
MlyI GAGTC 4 cut(s) 137, 578, 797, 815
MmeI TCCRAC 1 cut(s) 122
Mox20I TGGCCA 1 cut(s) 324
MscI TGGCCA 1 cut(s) 324
MseI TTAA 4 cut(s) 303, 687, 801, 848
MslI CAYNNNNRTG 1 cut(s) 285
Msp20I TGGCCA 1 cut(s) 324
MspI CCGG 3 cut(s) 262, 313, 716
MspR9I CCNGG 5 cut(s) 91, 263, 326, 517, 716
MunI CAATTG 2 cut(s) 330, 620
MvaI CCWGG 3 cut(s) 91, 326, 517
MwoI GCNNNNNNNGC 3 cut(s) 57, 185, 356
NciI CCSGG 2 cut(s) 263, 716
NcoI CCATGG 2 cut(s) 161, 573
NdeI CATATG 1 cut(s) 282
NdeII GATC 5 cut(s) 133, 144, 214, 403, 477
NlaIII CATG 4 cut(s) 165, 484, 577, 702
NlaIV GGNNCC 1 cut(s) 489
PfeI GAWTC 3 cut(s) 40, 253, 584
PfoI TCCNGGA 1 cut(s) 89
PleI GAGTC 4 cut(s) 136, 577, 796, 814
PpsI GAGTC 4 cut(s) 136, 577, 796, 814
Psp6I CCWGG 3 cut(s) 89, 324, 515
PspFI CCCAGC 1 cut(s) 693
PspGI CCWGG 3 cut(s) 89, 324, 515
PspN4I GGNNCC 1 cut(s) 489
PspPI GGNCC 2 cut(s) 165, 487
PsuI RGATCY 3 cut(s) 133, 144, 214
RsaI GTAC 2 cut(s) 673, 720
RsaNI GTAC 2 cut(s) 672, 719
RseI CAYNNNNRTG 1 cut(s) 285
SaqAI TTAA 4 cut(s) 303, 687, 801, 848
Sau3AI GATC 5 cut(s) 133, 144, 214, 403, 477
Sau96I GGNCC 2 cut(s) 165, 487
SchI GAGTC 4 cut(s) 137, 578, 797, 815
ScrFI CCNGG 5 cut(s) 91, 263, 326, 517, 716
SetI ASST 4 cut(s) 274, 619, 663, 774
SfaNI GCATC 2 cut(s) 267, 532
SfcI CTRYAG 1 cut(s) 189
SinI GGWCC 1 cut(s) 165
SmiI ATTTAAAT 1 cut(s) 849
SmiMI CAYNNNNRTG 1 cut(s) 285
SmlI CTYRAG 2 cut(s) 148, 442
SmoI CTYRAG 2 cut(s) 148, 442
Sse9I AATT 5 cut(s) 95, 330, 493, 620, 844
SsiI CCGC 3 cut(s) 16, 113, 194
SspI AATATT 1 cut(s) 245
SspMI CTAG 2 cut(s) 522, 871
StyD4I CCNGG 5 cut(s) 89, 261, 324, 515, 714
StyI CCWWGG 2 cut(s) 161, 573
SwaI ATTTAAAT 1 cut(s) 849
TaaI ACNGT 1 cut(s) 226
TaiI ACGT 1 cut(s) 774
TaqI TCGA 2 cut(s) 78, 809
TasI AATT 5 cut(s) 95, 330, 493, 620, 844
TfiI GAWTC 3 cut(s) 40, 253, 584
Tru1I TTAA 4 cut(s) 303, 687, 801, 848
Tru9I TTAA 4 cut(s) 303, 687, 801, 848
TscAI CASTG 1 cut(s) 214
TspDTI ATGAA 2 cut(s) 219, 306
TspRI CASTG 1 cut(s) 214
VpaK11BI GGWCC 1 cut(s) 165
XapI RAATTY 1 cut(s) 844
XspI CTAG 2 cut(s) 522, 871
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.