Rmu_sc0002048.1_g000024

Ribonuclease H protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0002048.1
OG0023025
Physical Location & Seq
Reverse (-)
89251 .. 92663
3413 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0002048.1_g000024.1.cds

Sequence Viewer

Length: 777 bp
atggctgttgagatagatattaagcatttggaagtggagactgattctggtatgttgtttaaccttctacacggtaacgatattgagcttcatcctcttggaaccttgttgtacaattgcagaattttggcacaatattttgaatcctactctacaaagcatatttacattgagagcaatacagtctctaatattttacccataaagagtcttgatcgagatctaggaacttatagcttcaataccaatctagtttttactactcaagctattttagatgacattgatggcctagtgagctcttctaaacaaaccgtcgttgtagccgccgcaatagagaagaaatttgctaggctgtcaccaccactggtatactctaacgtccccggaggtggccggaaaattccgccggagttagtggcagagccgccgccgaccaccaccaatggtgtcggggctggactaaactcaaggcgagatcaccagttcaagaatcacaagaaatggtggtctgtagctcgagatatcaggatcaatagctcggttttctatttggatcggttctggcttccagccgccaccacgcgctgcgtcgccttgcaaggacacttctggaagcttcaggaggttgaggcgagctcgaggaaaattttggtgaggattggtggccggaaacaggaggaggatgagttggttcggtttcgggtgcaaccggatcgagctggtttgccggaccttgaggatgtgccagagggaacgacgacgtccaactggtag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

258

Amino Acids

29.02

Weight (kDa)

6.39

Isoelectric Point (pI)

45.27

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0023025)

Species Orthologous Gene IDs
rosa_multiflora Rmu_sc0002048.1_g000024 Rmu_ssc0000295.1_g000020
rosa_samantha Rh6CG110300 Rh6DG099900

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AatII GACGTC 1 cut(s) 767
AccI GTMKAC 1 cut(s) 372
AccII CGCG 1 cut(s) 586
AciI CCGC 6 cut(s) 327, 330, 407, 428, 431, 576
AclWI GGATC 3 cut(s) 539, 564, 723
AcoI YGGCCR 2 cut(s) 394, 667
AcsI RAATTY 4 cut(s) 123, 344, 402, 648
AcuI CTGAAG 1 cut(s) 605
AcyI GRCGYC 1 cut(s) 764
AfaI GTAC 1 cut(s) 113
AfiI CCNNNNNNNGG 2 cut(s) 392, 676
AgsI TTSAA 3 cut(s) 143, 241, 490
AluBI AGCT 9 cut(s) 88, 237, 269, 300, 518, 540, 619, 639, 722
AluI AGCT 9 cut(s) 88, 237, 269, 300, 518, 540, 619, 639, 722
Alw21I GWGCWC 2 cut(s) 302, 641
Alw26I GTCTC 2 cut(s) 32, 190
AlwI GGATC 3 cut(s) 539, 564, 723
Ama87I CYCGRG 2 cut(s) 519, 640
AoxI GGCC 3 cut(s) 289, 394, 667
ApeKI GCWGC 1 cut(s) 588
ApoI RAATTY 4 cut(s) 123, 344, 402, 648
AspLEI GCGC 1 cut(s) 588
AspS9I GGNCC 1 cut(s) 733
AsuC2I CCSGG 1 cut(s) 387
AsuHPI GGTGA 3 cut(s) 351, 473, 667
AvaI CYCGRG 2 cut(s) 519, 640
AvaII GGWCC 1 cut(s) 733
BanII GRGCYC 2 cut(s) 302, 641
Bbv12I GWGCWC 2 cut(s) 302, 641
BbvI GCAGC 1 cut(s) 575
BccI CCATC 1 cut(s) 281
BcgI CGANNNNNNTGC 2 cut(s) 698, 732
BcnI CCSGG 1 cut(s) 387
BcoDI GTCTC 2 cut(s) 32, 190
BfaI CTAG 4 cut(s) 224, 251, 293, 351
BfmI CTRYAG 1 cut(s) 513
BglII AGATCT 1 cut(s) 220
BisI GCNGC 6 cut(s) 327, 330, 428, 431, 576, 589
BlsI GCNGC 6 cut(s) 328, 331, 429, 432, 577, 590
Bme1390I CCNGG 1 cut(s) 387
Bme18I GGWCC 1 cut(s) 733
BmeT110I CYCGRG 2 cut(s) 519, 640
BmgT120I GGNCC 1 cut(s) 733
BmiI GGNNCC 1 cut(s) 103
BmrFI CCNGG 1 cut(s) 387
BplI GAGNNNNNCTC 2 cut(s) 623, 655
BpuEI CTTGAG 3 cut(s) 249, 454, 758
BpuMI CCSGG 1 cut(s) 387
BsaBI GATNNNNATC 1 cut(s) 219
BsaHI GRCGYC 1 cut(s) 764
BsaJI CCNNGG 1 cut(s) 385
BsaWI WCCGGW 1 cut(s) 712
BsaXI ACNNNNNCTCC 2 cut(s) 674, 704
Bsc4I CCNNNNNNNGG 2 cut(s) 392, 676
Bse1I ACTGG 3 cut(s) 372, 484, 776
Bse8I GATNNNNATC 1 cut(s) 219
BseDI CCNNGG 1 cut(s) 385
BseGI GGATG 3 cut(s) 91, 691, 748
BseJI GATNNNNATC 1 cut(s) 219
BseLI CCNNNNNNNGG 2 cut(s) 392, 676
BseNI ACTGG 3 cut(s) 372, 484, 776
BseRI GAGGAG 1 cut(s) 695
BseXI GCAGC 1 cut(s) 575
Bsh1236I CGCG 1 cut(s) 586
BshFI GGCC 3 cut(s) 291, 396, 669
BsiHKAI GWGCWC 2 cut(s) 302, 641
BsiHKCI CYCGRG 2 cut(s) 519, 640
BsiSI CCGG 6 cut(s) 387, 397, 410, 670, 713, 731
BslFI GGGAC 1 cut(s) 368
BslI CCNNNNNNNGG 2 cut(s) 392, 676
BsmAI GTCTC 2 cut(s) 32, 190
BsmFI GGGAC 1 cut(s) 368
BsnI GGCC 3 cut(s) 291, 396, 669
BsoBI CYCGRG 2 cut(s) 519, 640
Bsp1286I GDGCHC 2 cut(s) 302, 641
Bsp1407I TGTACA 1 cut(s) 111
Bsp143I GATC 6 cut(s) 214, 220, 478, 531, 556, 715
BspACI CCGC 6 cut(s) 327, 330, 407, 428, 431, 576
BspANI GGCC 3 cut(s) 291, 396, 669
BspFNI CGCG 1 cut(s) 586
BspLI GGNNCC 1 cut(s) 103
BspPI GGATC 3 cut(s) 539, 564, 723
BspQI GCTCTTC 1 cut(s) 307
BsrGI TGTACA 1 cut(s) 111
BsrI ACTGG 3 cut(s) 372, 484, 776
BssECI CCNNGG 1 cut(s) 385
BssMI GATC 6 cut(s) 214, 220, 478, 531, 556, 715
BssNAI GTATAC 1 cut(s) 373
BssNI GRCGYC 1 cut(s) 764
Bst1107I GTATAC 1 cut(s) 373
Bst4CI ACNGT 3 cut(s) 74, 184, 316
Bst6I CTCTTC 1 cut(s) 307
BstACI GRCGYC 1 cut(s) 764
BstAUI TGTACA 1 cut(s) 111
BstC8I GCNNGC 1 cut(s) 637
BstF5I GGATG 3 cut(s) 91, 691, 748
BstFNI CGCG 1 cut(s) 586
BstHHI GCGC 1 cut(s) 588
BstKTI GATC 6 cut(s) 217, 223, 481, 534, 559, 718
BstMAI GTCTC 2 cut(s) 32, 190
BstMBI GATC 6 cut(s) 214, 220, 478, 531, 556, 715
BstMWI GCNNNNNNNGC 1 cut(s) 297
BstSCI CCNGG 1 cut(s) 385
BstSFI CTRYAG 1 cut(s) 513
BstUI CGCG 1 cut(s) 586
BstV1I GCAGC 1 cut(s) 575
BstX2I RGATCY 1 cut(s) 220
BstYI RGATCY 1 cut(s) 220
BstZ17I GTATAC 1 cut(s) 373
BsuRI GGCC 3 cut(s) 291, 396, 669
BtsCI GGATG 3 cut(s) 91, 691, 748
BtsIMutI CAGTG 1 cut(s) 365
Cac8I GCNNGC 1 cut(s) 637
CfoI GCGC 1 cut(s) 588
Cfr13I GGNCC 1 cut(s) 733
CseI GACGC 1 cut(s) 580
Csp6I GTAC 1 cut(s) 112
CviQI GTAC 1 cut(s) 112
DpnI GATC 6 cut(s) 216, 222, 480, 533, 558, 717
DpnII GATC 6 cut(s) 214, 220, 478, 531, 556, 715
EaeI YGGCCR 2 cut(s) 394, 667
Eam1104I CTCTTC 1 cut(s) 307
EarI CTCTTC 1 cut(s) 307
EciI GGCGGA 1 cut(s) 396
Ecl136II GAGCTC 2 cut(s) 300, 639
Eco24I GRGCYC 2 cut(s) 302, 641
Eco32I GATATC 1 cut(s) 526
Eco47I GGWCC 1 cut(s) 733
Eco53kI GAGCTC 2 cut(s) 300, 639
Eco57I CTGAAG 1 cut(s) 605
Eco88I CYCGRG 2 cut(s) 519, 640
EcoICRI GAGCTC 2 cut(s) 300, 639
EcoRV GATATC 1 cut(s) 526
EcoT38I GRGCYC 2 cut(s) 302, 641
FaiI YATR 5 cut(s) 53, 162, 203, 234, 373
FaqI GGGAC 1 cut(s) 368
FblI GTMKAC 1 cut(s) 372
Fnu4HI GCNGC 6 cut(s) 327, 330, 428, 431, 576, 589
FokI GGATG 3 cut(s) 78, 698, 755
FriOI GRGCYC 2 cut(s) 302, 641
Fsp4HI GCNGC 6 cut(s) 327, 330, 428, 431, 576, 589
FspBI CTAG 4 cut(s) 224, 251, 293, 351
GlaI GCGC 1 cut(s) 587
GluI GCNGC 6 cut(s) 327, 330, 428, 431, 576, 589
HaeIII GGCC 3 cut(s) 291, 396, 669
HapII CCGG 6 cut(s) 387, 397, 410, 670, 713, 731
HgaI GACGC 1 cut(s) 580
HhaI GCGC 1 cut(s) 588
Hin1I GRCGYC 1 cut(s) 764
Hin6I GCGC 1 cut(s) 586
HinP1I GCGC 1 cut(s) 586
HindIII AAGCTT 1 cut(s) 617
HinfI GANTC 4 cut(s) 44, 143, 208, 493
HpaII CCGG 6 cut(s) 387, 397, 410, 670, 713, 731
HphI GGTGA 3 cut(s) 351, 473, 667
Hpy166II GTNNAC 1 cut(s) 373
Hpy188III TCNNGA 7 cut(s) 212, 218, 490, 521, 529, 613, 623
Hpy8I GTNNAC 1 cut(s) 373
Hpy99I CGWCG 4 cut(s) 320, 596, 763, 766
HpyAV CCTTC 1 cut(s) 74
HpyCH4III ACNGT 3 cut(s) 74, 184, 316
HpyCH4IV ACGT 2 cut(s) 381, 764
HpyCH4V TGCA 3 cut(s) 120, 601, 709
HpyF10VI GCNNNNNNNGC 1 cut(s) 297
HpySE526I ACGT 2 cut(s) 381, 764
Hsp92I GRCGYC 1 cut(s) 764
HspAI GCGC 1 cut(s) 586
Kzo9I GATC 6 cut(s) 214, 220, 478, 531, 556, 715
LguI GCTCTTC 1 cut(s) 307
Lsp1109I GCAGC 1 cut(s) 575
MaeI CTAG 4 cut(s) 224, 251, 293, 351
MaeII ACGT 2 cut(s) 381, 764
MaeIII GTNAC 2 cut(s) 74, 357
MalI GATC 6 cut(s) 216, 222, 480, 533, 558, 717
MboI GATC 6 cut(s) 214, 220, 478, 531, 556, 715
MboII GAAGA 2 cut(s) 294, 352
MfeI CAATTG 1 cut(s) 115
MflI RGATCY 1 cut(s) 220
MhlI GDGCHC 2 cut(s) 302, 641
MluCI AATT 5 cut(s) 115, 123, 344, 402, 648
MlyI GAGTC 1 cut(s) 217
MseI TTAA 2 cut(s) 21, 60
MspI CCGG 6 cut(s) 387, 397, 410, 670, 713, 731
MspR9I CCNGG 1 cut(s) 387
MunI CAATTG 1 cut(s) 115
MvnI CGCG 1 cut(s) 586
MwoI GCNNNNNNNGC 1 cut(s) 297
NciI CCSGG 1 cut(s) 387
NdeII GATC 6 cut(s) 214, 220, 478, 531, 556, 715
NlaIV GGNNCC 1 cut(s) 103
NmuCI GTSAC 1 cut(s) 357
PaeR7I CTCGAG 2 cut(s) 519, 640
PciSI GCTCTTC 1 cut(s) 307
PfeI GAWTC 3 cut(s) 44, 143, 493
PflFI GACNNNGTC 1 cut(s) 763
PkrI GCNGC 6 cut(s) 328, 331, 429, 432, 577, 590
PleI GAGTC 1 cut(s) 216
PpsI GAGTC 1 cut(s) 216
Psp124BI GAGCTC 2 cut(s) 302, 641
PspN4I GGNNCC 1 cut(s) 103
PspPI GGNCC 1 cut(s) 733
PspXI VCTCGAGB 1 cut(s) 640
PsuI RGATCY 1 cut(s) 220
PsyI GACNNNGTC 1 cut(s) 763
RsaI GTAC 1 cut(s) 113
RsaNI GTAC 1 cut(s) 112
SacI GAGCTC 2 cut(s) 302, 641
SapI GCTCTTC 1 cut(s) 307
SaqAI TTAA 2 cut(s) 21, 60
SatI GCNGC 6 cut(s) 327, 330, 428, 431, 576, 589
Sau3AI GATC 6 cut(s) 214, 220, 478, 531, 556, 715
Sau96I GGNCC 1 cut(s) 733
SchI GAGTC 1 cut(s) 217
ScrFI CCNGG 1 cut(s) 387
SduI GDGCHC 2 cut(s) 302, 641
SfcI CTRYAG 1 cut(s) 513
Sfr274I CTCGAG 2 cut(s) 519, 640
SinI GGWCC 1 cut(s) 733
SlaI CTCGAG 2 cut(s) 519, 640
SmlI CTYRAG 5 cut(s) 264, 469, 519, 640, 737
SmoI CTYRAG 5 cut(s) 264, 469, 519, 640, 737
Sse9I AATT 5 cut(s) 115, 123, 344, 402, 648
SsiI CCGC 6 cut(s) 327, 330, 407, 428, 431, 576
SspI AATATT 2 cut(s) 137, 193
SspMI CTAG 4 cut(s) 224, 251, 293, 351
SstI GAGCTC 2 cut(s) 302, 641
StyD4I CCNGG 1 cut(s) 385
TaaI ACNGT 3 cut(s) 74, 184, 316
TaiI ACGT 2 cut(s) 384, 767
TaqI TCGA 4 cut(s) 217, 520, 641, 718
TasI AATT 5 cut(s) 115, 123, 344, 402, 648
TatI WGTACW 1 cut(s) 111
TauI GCSGC 5 cut(s) 329, 332, 430, 433, 578
TfiI GAWTC 3 cut(s) 44, 143, 493
Tru1I TTAA 2 cut(s) 21, 60
Tru9I TTAA 2 cut(s) 21, 60
TscAI CASTG 1 cut(s) 372
TseFI GTSAC 1 cut(s) 357
TseI GCWGC 1 cut(s) 588
Tsp45I GTSAC 1 cut(s) 357
TspDTI ATGAA 1 cut(s) 80
TspRI CASTG 1 cut(s) 372
Tth111I GACNNNGTC 1 cut(s) 763
VpaK11BI GGWCC 1 cut(s) 733
XapI RAATTY 4 cut(s) 123, 344, 402, 648
XhoI CTCGAG 2 cut(s) 519, 640
XmiI GTMKAC 1 cut(s) 372
XspI CTAG 4 cut(s) 224, 251, 293, 351
ZraI GACGTC 1 cut(s) 765
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.