Rmu_sc0002131.1_g000002

Nitroreductase family

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0002131.1
OG0025467
Physical Location & Seq
Reverse (-)
592 .. 2402
1811 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0002131.1_g000002.1.cds

Sequence Viewer

Length: 840 bp
atgtccttctcttcctcctctccttccccttcttcactctccacccccaaactacccgaccagcaactcgaccaaaacccctcgcaggtcctcacgtaccacaacgataccaagcaccacttcgctcgctacgccagaggccgtcgcagactcgactgggccaaccagcccaacccattctgccgctacctctccgcccctctcctctaccccacaccacccaactatcacccctcccctctctactccctcttcacctctcttcctcctccaaaacccatctccaaatccaccatttcccaactcctttacaactctctagctctctcctcttggaaaaccaccggcttctccacctggtctctcaaagtcaatcccagcagcggtaatctacaccccaccgaggcttatatagtctccctgccgatcccttccctctctgattccggcttcgtggcccatccattaaatgggtgtctggcaggaacaagatgggttactatgattgcagcgggtttcagagaacgcctcccatgggtaggcgattctgaaccttcctccatctccgatggagtaaacttcctgcgcctcctttggtgtcgcagaattcgaactgcttcgcactcgagattggaatttctttcgattcggcgcacaagattggtggctgctagtggctggaaggtttgggatccagggaccccaatgtcttcgaggtcaggattcagattagcagcggctccggcaggtctgcagtcggatcgagccgttttccttcatcatggatggcagcaggcatggcagaactatcttttgtctgatcatcagacgggttggtag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Nitroreductase

Protein Analysis

279

Amino Acids

31.23

Weight (kDa)

10.11

Isoelectric Point (pI)

53.94

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0025467)

Species Orthologous Gene IDs
rosa_multiflora Rmu_sc0001089.1_g000019 Rmu_sc0002131.1_g000002 Rmu_ssc0000456.1_g000022

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AasI GACNNNNNNGTC 1 cut(s) 706
Acc36I ACCTGC 2 cut(s) 76, 737
AccB7I CCANNNNNTGG 1 cut(s) 470
AciI CCGC 5 cut(s) 184, 195, 384, 512, 737
AclWI GGATC 4 cut(s) 421, 686, 699, 768
AcsI RAATTY 2 cut(s) 606, 635
AfaI GTAC 1 cut(s) 98
AfiI CCNNNNNNNGG 6 cut(s) 85, 383, 403, 470, 535, 539
AjnI CCWGG 2 cut(s) 356, 694
AjuI GAANNNNNNNTTGG 2 cut(s) 104, 136
AluBI AGCT 1 cut(s) 323
AluI AGCT 1 cut(s) 323
Alw26I GTCTC 2 cut(s) 366, 421
AlwI GGATC 4 cut(s) 421, 686, 699, 768
Ama87I CYCGRG 1 cut(s) 625
AoxI GGCC 3 cut(s) 139, 159, 456
ApeKI GCWGC 5 cut(s) 381, 509, 668, 734, 790
ApoI RAATTY 2 cut(s) 606, 635
Asp700I GAANNNNTTC 1 cut(s) 616
AspLEI GCGC 2 cut(s) 588, 654
AspS9I GGNCC 4 cut(s) 88, 159, 457, 699
AsuHPI GGTGA 2 cut(s) 221, 247
AsuII TTCGAA 1 cut(s) 610
AvaI CYCGRG 1 cut(s) 625
AvaII GGWCC 2 cut(s) 88, 699
BamHI GGATCC 1 cut(s) 691
BbsI GAAGAC 1 cut(s) 702
BbvI GCAGC 5 cut(s) 393, 521, 655, 746, 802
BccI CCATC 6 cut(s) 287, 468, 486, 563, 569, 780
BceAI ACGGC 2 cut(s) 126, 752
BcgI CGANNNNNNTGC 2 cut(s) 743, 777
BciT130I CCWGG 2 cut(s) 358, 696
BclI TGATCA 1 cut(s) 820
BcoDI GTCTC 2 cut(s) 366, 421
BfaI CTAG 2 cut(s) 320, 672
BfmI CTRYAG 1 cut(s) 752
BfuAI ACCTGC 2 cut(s) 76, 737
BisI GCNGC 7 cut(s) 184, 382, 510, 669, 735, 738, 791
BlsI GCNGC 7 cut(s) 185, 383, 511, 670, 736, 739, 792
Bme1390I CCNGG 2 cut(s) 358, 696
Bme18I GGWCC 2 cut(s) 88, 699
BmeT110I CYCGRG 1 cut(s) 625
BmgT120I GGNCC 4 cut(s) 88, 159, 457, 699
BmiI GGNNCC 4 cut(s) 693, 700, 701, 741
BmrFI CCNGG 2 cut(s) 358, 696
BmrI ACTGGG 1 cut(s) 166
BmuI ACTGGG 1 cut(s) 166
BpiI GAAGAC 1 cut(s) 702
BplI GAGNNNNNCTC 2 cut(s) 513, 545
Bpu14I TTCGAA 1 cut(s) 610
BsaAI YACGTR 1 cut(s) 96
BsaI GGTCTC 1 cut(s) 366
BsaJI CCNNGG 3 cut(s) 402, 533, 695
Bsc4I CCNNNNNNNGG 6 cut(s) 85, 383, 403, 470, 535, 539
Bse118I RCCGGY 1 cut(s) 344
Bse1I ACTGG 1 cut(s) 161
BseBI CCWGG 2 cut(s) 358, 696
BseDI CCNNGG 3 cut(s) 402, 533, 695
BseGI GGATG 2 cut(s) 460, 791
BseLI CCNNNNNNNGG 6 cut(s) 85, 383, 403, 470, 535, 539
BseNI ACTGG 1 cut(s) 161
BseRI GAGGAG 4 cut(s) 7, 194, 258, 319
BseXI GCAGC 5 cut(s) 393, 521, 655, 746, 802
BseYI CCCAGC 1 cut(s) 377
BshFI GGCC 3 cut(s) 141, 161, 458
BsiHKCI CYCGRG 1 cut(s) 625
BsiSI CCGG 3 cut(s) 345, 447, 743
BslFI GGGAC 1 cut(s) 712
BslI CCNNNNNNNGG 6 cut(s) 85, 383, 403, 470, 535, 539
BsmAI GTCTC 2 cut(s) 366, 421
BsmFI GGGAC 1 cut(s) 712
BsnI GGCC 3 cut(s) 141, 161, 458
Bso31I GGTCTC 1 cut(s) 366
BsoBI CYCGRG 1 cut(s) 625
Bsp119I TTCGAA 1 cut(s) 610
Bsp143I GATC 4 cut(s) 426, 691, 760, 820
Bsp19I CCATGG 1 cut(s) 533
BspACI CCGC 5 cut(s) 184, 195, 384, 512, 737
BspANI GGCC 3 cut(s) 141, 161, 458
BspLI GGNNCC 4 cut(s) 693, 700, 701, 741
BspMAI CTGCAG 1 cut(s) 756
BspMI ACCTGC 2 cut(s) 76, 737
BspPI GGATC 4 cut(s) 421, 686, 699, 768
BspT104I TTCGAA 1 cut(s) 610
BspTNI GGTCTC 1 cut(s) 366
BsrFI RCCGGY 1 cut(s) 344
BsrI ACTGG 1 cut(s) 161
BssAI RCCGGY 1 cut(s) 344
BssECI CCNNGG 3 cut(s) 402, 533, 695
BssMI GATC 4 cut(s) 426, 691, 760, 820
BssT1I CCWWGG 1 cut(s) 533
Bst2UI CCWGG 2 cut(s) 358, 696
Bst6I CTCTTC 3 cut(s) 16, 257, 267
BstBAI YACGTR 1 cut(s) 96
BstBI TTCGAA 1 cut(s) 610
BstC8I GCNNGC 2 cut(s) 127, 795
BstDSI CCRYGG 1 cut(s) 533
BstF5I GGATG 2 cut(s) 460, 791
BstHHI GCGC 2 cut(s) 588, 654
BstKTI GATC 4 cut(s) 429, 694, 763, 823
BstMAI GTCTC 2 cut(s) 366, 421
BstMBI GATC 4 cut(s) 426, 691, 760, 820
BstMWI GCNNNNNNNGC 3 cut(s) 131, 743, 799
BstNI CCWGG 2 cut(s) 358, 696
BstSCI CCNGG 2 cut(s) 356, 694
BstSFI CTRYAG 1 cut(s) 752
BstV1I GCAGC 5 cut(s) 393, 521, 655, 746, 802
BstV2I GAAGAC 1 cut(s) 702
BstX2I RGATCY 1 cut(s) 691
BstYI RGATCY 1 cut(s) 691
BsuRI GGCC 3 cut(s) 141, 161, 458
BtgI CCRYGG 1 cut(s) 533
BtsCI GGATG 2 cut(s) 460, 791
BveI ACCTGC 2 cut(s) 76, 737
Cac8I GCNNGC 2 cut(s) 127, 795
CfoI GCGC 2 cut(s) 588, 654
Cfr10I RCCGGY 1 cut(s) 344
Cfr13I GGNCC 4 cut(s) 88, 159, 457, 699
CsiI ACCWGGT 1 cut(s) 356
Csp6I GTAC 1 cut(s) 97
CspCI CAANNNNNGTGG 2 cut(s) 645, 680
CviAII CATG 3 cut(s) 534, 782, 798
CviQI GTAC 1 cut(s) 97
DpnI GATC 4 cut(s) 428, 693, 762, 822
DpnII GATC 4 cut(s) 426, 691, 760, 820
DrdI GACNNNNNNGTC 1 cut(s) 706
DseDI GACNNNNNNGTC 1 cut(s) 706
Eam1104I CTCTTC 3 cut(s) 16, 257, 267
EarI CTCTTC 3 cut(s) 16, 257, 267
EciI GGCGGA 1 cut(s) 184
Eco130I CCWWGG 1 cut(s) 533
Eco31I GGTCTC 1 cut(s) 366
Eco47I GGWCC 2 cut(s) 88, 699
Eco88I CYCGRG 1 cut(s) 625
EcoO109I RGGNCCY 2 cut(s) 88, 699
EcoRI GAATTC 1 cut(s) 606
EcoRII CCWGG 2 cut(s) 356, 694
EcoT14I CCWWGG 1 cut(s) 533
ErhI CCWWGG 1 cut(s) 533
FaeI CATG 3 cut(s) 537, 785, 801
FaiI YATR 6 cut(s) 411, 413, 503, 535, 783, 799
FalI AAGNNNNNCTT 2 cut(s) 104, 136
FaqI GGGAC 1 cut(s) 712
FatI CATG 3 cut(s) 533, 781, 797
FauI CCCGC 1 cut(s) 505
FbaI TGATCA 1 cut(s) 820
Fnu4HI GCNGC 7 cut(s) 184, 382, 510, 669, 735, 738, 791
FokI GGATG 2 cut(s) 447, 798
Fsp4HI GCNGC 7 cut(s) 184, 382, 510, 669, 735, 738, 791
FspBI CTAG 2 cut(s) 320, 672
GlaI GCGC 2 cut(s) 587, 653
GluI GCNGC 7 cut(s) 184, 382, 510, 669, 735, 738, 791
GsaI CCCAGC 1 cut(s) 381
HaeIII GGCC 3 cut(s) 141, 161, 458
HapII CCGG 3 cut(s) 345, 447, 743
HhaI GCGC 2 cut(s) 588, 654
Hin1II CATG 3 cut(s) 537, 785, 801
Hin6I GCGC 2 cut(s) 586, 652
HinP1I GCGC 2 cut(s) 586, 652
HinfI GANTC 5 cut(s) 150, 443, 545, 646, 723
HpaII CCGG 3 cut(s) 345, 447, 743
HphI GGTGA 2 cut(s) 221, 247
Hpy166II GTNNAC 1 cut(s) 577
Hpy188I TCNGA 8 cut(s) 442, 521, 550, 568, 728, 760, 820, 828
Hpy188III TCNNGA 2 cut(s) 627, 720
Hpy8I GTNNAC 1 cut(s) 577
Hpy99I CGWCG 1 cut(s) 147
HpyAV CCTTC 7 cut(s) 16, 33, 39, 441, 564, 676, 785
HpyCH4IV ACGT 1 cut(s) 95
HpyCH4V TGCA 2 cut(s) 509, 754
HpyF10VI GCNNNNNNNGC 3 cut(s) 131, 743, 799
HpySE526I ACGT 1 cut(s) 95
Hsp92II CATG 3 cut(s) 537, 785, 801
HspAI GCGC 2 cut(s) 586, 652
KflI GGGWCCC 1 cut(s) 699
Ksp22I TGATCA 1 cut(s) 820
Kzo9I GATC 4 cut(s) 426, 691, 760, 820
LmnI GCTCC 1 cut(s) 745
Lsp1109I GCAGC 5 cut(s) 393, 521, 655, 746, 802
MabI ACCWGGT 1 cut(s) 356
MaeI CTAG 2 cut(s) 320, 672
MaeII ACGT 1 cut(s) 95
MaeIII GTNAC 1 cut(s) 496
MalI GATC 4 cut(s) 428, 693, 762, 822
MboI GATC 4 cut(s) 426, 691, 760, 820
MboII GAAGA 5 cut(s) 3, 24, 244, 254, 702
MflI RGATCY 1 cut(s) 691
MluCI AATT 2 cut(s) 606, 635
MlyI GAGTC 1 cut(s) 144
MmeI TCCRAC 1 cut(s) 738
MroXI GAANNNNTTC 1 cut(s) 616
MseI TTAA 1 cut(s) 467
MspA1I CMGCKG 3 cut(s) 384, 512, 737
MspI CCGG 3 cut(s) 345, 447, 743
MspR9I CCNGG 2 cut(s) 358, 696
MvaI CCWGG 2 cut(s) 358, 696
MwoI GCNNNNNNNGC 3 cut(s) 131, 743, 799
NcoI CCATGG 1 cut(s) 533
NdeII GATC 4 cut(s) 426, 691, 760, 820
NlaIII CATG 3 cut(s) 537, 785, 801
NlaIV GGNNCC 4 cut(s) 693, 700, 701, 741
NspV TTCGAA 1 cut(s) 610
PaeR7I CTCGAG 1 cut(s) 625
PcsI WCGNNNNNNNCGW 1 cut(s) 607
PdmI GAANNNNTTC 1 cut(s) 616
PfeI GAWTC 4 cut(s) 443, 545, 646, 723
PflMI CCANNNNNTGG 1 cut(s) 470
PkrI GCNGC 7 cut(s) 185, 383, 511, 670, 736, 739, 792
PleI GAGTC 1 cut(s) 144
PpsI GAGTC 1 cut(s) 144
Ppu21I YACGTR 1 cut(s) 96
PpuMI RGGWCCY 2 cut(s) 88, 699
Psp5II RGGWCCY 2 cut(s) 88, 699
Psp6I CCWGG 2 cut(s) 356, 694
PspFI CCCAGC 1 cut(s) 377
PspGI CCWGG 2 cut(s) 356, 694
PspN4I GGNNCC 4 cut(s) 693, 700, 701, 741
PspPI GGNCC 4 cut(s) 88, 159, 457, 699
PspPPI RGGWCCY 2 cut(s) 88, 699
PstI CTGCAG 1 cut(s) 756
PsuI RGATCY 1 cut(s) 691
RsaI GTAC 1 cut(s) 98
RsaNI GTAC 1 cut(s) 97
SaqAI TTAA 1 cut(s) 467
SatI GCNGC 7 cut(s) 184, 382, 510, 669, 735, 738, 791
Sau3AI GATC 4 cut(s) 426, 691, 760, 820
Sau96I GGNCC 4 cut(s) 88, 159, 457, 699
SchI GAGTC 1 cut(s) 144
ScrFI CCNGG 2 cut(s) 358, 696
SexAI ACCWGGT 1 cut(s) 356
SfcI CTRYAG 1 cut(s) 752
Sfr274I CTCGAG 1 cut(s) 625
SfuI TTCGAA 1 cut(s) 610
SinI GGWCC 2 cut(s) 88, 699
SlaI CTCGAG 1 cut(s) 625
SmlI CTYRAG 1 cut(s) 625
SmoI CTYRAG 1 cut(s) 625
Sse9I AATT 2 cut(s) 606, 635
SsiI CCGC 5 cut(s) 184, 195, 384, 512, 737
SspMI CTAG 2 cut(s) 320, 672
StyD4I CCNGG 2 cut(s) 356, 694
StyI CCWWGG 1 cut(s) 533
TaiI ACGT 1 cut(s) 98
TaqI TCGA 7 cut(s) 69, 153, 610, 626, 644, 713, 763
TasI AATT 2 cut(s) 606, 635
TauI GCSGC 2 cut(s) 186, 740
TfiI GAWTC 4 cut(s) 443, 545, 646, 723
Tru1I TTAA 1 cut(s) 467
Tru9I TTAA 1 cut(s) 467
TseI GCWGC 5 cut(s) 381, 509, 668, 734, 790
TspDTI ATGAA 1 cut(s) 767
Van91I CCANNNNNTGG 1 cut(s) 470
VpaK11BI GGWCC 2 cut(s) 88, 699
XapI RAATTY 2 cut(s) 606, 635
XcmI CCANNNNNNNNNTGG 1 cut(s) 467
XhoI CTCGAG 1 cut(s) 625
XmnI GAANNNNTTC 1 cut(s) 616
XspI CTAG 2 cut(s) 320, 672
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.