Rmu_sc0002417.1_g000002

Caffeoylshikimate esterase-like

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0002417.1
OG0031210
Physical Location & Seq
Reverse (-)
16930 .. 19740
2811 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0002417.1_g000002.1.cds

Sequence Viewer

Length: 405 bp
atggagacgggaacggggaatccccagtatcttattactgggattggggagggtaaggggatggagaatgaagtcggtcatcagggggagacacagacatcagggggagatgtctgcatgttcgtctcgaatcgtgaaggtggtatggaaggaattcaaggggtatggaaattttctgcaaaagctggttgccaaaaccaggtgatcaaatcaaagctggcttatgtttttgccatgggtattgctaggagaattgctcagtctgggtacgttgtgtatgcagtagactatccaggttttggtctttctgtagggttgcatggtttcatcccaaactttgatgagttggtcgatgatgttattgaacaatttactagtatcaaaggtgtgaaattgattggttag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko00561 ko01100 ko04714 ko04723 ko04923 map00561 map01100 map04714 map04723 map04923
Pfam Domains
Protein Families
Hydrolase_4

Protein Analysis

134

Amino Acids

14.3

Weight (kDa)

5.06

Isoelectric Point (pI)

10.26

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0031210)

Species Orthologous Gene IDs
rosa_multiflora Rmu_sc0002417.1_g000002
rosa_samantha Rh6AG426300

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 299
AccI GTMKAC 1 cut(s) 285
AcsI RAATTY 2 cut(s) 153, 170
AfaI GTAC 1 cut(s) 269
AfiI CCNNNNNNNGG 2 cut(s) 199, 299
AgsI TTSAA 2 cut(s) 158, 365
AhlI ACTAGT 1 cut(s) 374
AjnI CCWGG 2 cut(s) 198, 292
AloI GAACNNNNNNTCC 1 cut(s) 36
AluBI AGCT 2 cut(s) 185, 217
AluI AGCT 2 cut(s) 185, 217
Alw26I GTCTC 2 cut(s) 83, 130
ApoI RAATTY 2 cut(s) 153, 170
Asp700I GAANNNNTTC 1 cut(s) 153
AsuHPI GGTGA 1 cut(s) 214
BccI CCATC 1 cut(s) 55
BciT130I CCWGG 2 cut(s) 200, 294
BclI TGATCA 1 cut(s) 204
BcoDI GTCTC 2 cut(s) 83, 130
BcuI ACTAGT 1 cut(s) 374
BfaI CTAG 2 cut(s) 246, 375
BfmI CTRYAG 1 cut(s) 309
Bme1390I CCNGG 2 cut(s) 200, 294
BmrFI CCNGG 2 cut(s) 200, 294
BmrI ACTGGG 2 cut(s) 19, 48
BmuI ACTGGG 2 cut(s) 19, 48
BplI GAGNNNNNCTC 2 cut(s) 241, 273
BsaJI CCNNGG 1 cut(s) 234
Bsc4I CCNNNNNNNGG 2 cut(s) 199, 299
Bse1I ACTGG 2 cut(s) 25, 43
BseBI CCWGG 2 cut(s) 200, 294
BseDI CCNNGG 1 cut(s) 234
BseGI GGATG 2 cut(s) 66, 327
BseLI CCNNNNNNNGG 2 cut(s) 199, 299
BseMII CTCAG 1 cut(s) 272
BseNI ACTGG 2 cut(s) 25, 43
BslI CCNNNNNNNGG 2 cut(s) 199, 299
BsmAI GTCTC 2 cut(s) 83, 130
BsmBI CGTCTC 1 cut(s) 130
Bsp143I GATC 1 cut(s) 204
Bsp19I CCATGG 1 cut(s) 234
BspCNI CTCAG 1 cut(s) 271
BsrI ACTGG 2 cut(s) 25, 43
BssECI CCNNGG 1 cut(s) 234
BssMI GATC 1 cut(s) 204
BssT1I CCWWGG 1 cut(s) 234
Bst2UI CCWGG 2 cut(s) 200, 294
BstC8I GCNNGC 1 cut(s) 219
BstDEI CTNAG 1 cut(s) 258
BstDSI CCRYGG 1 cut(s) 234
BstF5I GGATG 2 cut(s) 66, 327
BstKTI GATC 1 cut(s) 207
BstMAI GTCTC 2 cut(s) 83, 130
BstMBI GATC 1 cut(s) 204
BstNI CCWGG 2 cut(s) 200, 294
BstNSI RCATGY 1 cut(s) 121
BstSCI CCNGG 2 cut(s) 198, 292
BstSFI CTRYAG 1 cut(s) 309
BtgI CCRYGG 1 cut(s) 234
BtsCI GGATG 2 cut(s) 66, 327
Cac8I GCNNGC 1 cut(s) 219
CsiI ACCWGGT 1 cut(s) 198
Csp6I GTAC 1 cut(s) 268
CviAII CATG 3 cut(s) 118, 235, 320
CviJI RGCY 3 cut(s) 185, 217, 221
CviKI_1 RGCY 3 cut(s) 185, 217, 221
CviQI GTAC 1 cut(s) 268
DdeI CTNAG 1 cut(s) 258
DpnI GATC 1 cut(s) 206
DpnII GATC 1 cut(s) 204
Eco130I CCWWGG 1 cut(s) 234
EcoRI GAATTC 1 cut(s) 153
EcoRII CCWGG 2 cut(s) 198, 292
EcoT14I CCWWGG 1 cut(s) 234
ErhI CCWWGG 1 cut(s) 234
Esp3I CGTCTC 1 cut(s) 130
FaeI CATG 3 cut(s) 121, 238, 323
FaiI YATR 7 cut(s) 119, 146, 166, 225, 236, 279, 321
FatI CATG 3 cut(s) 117, 234, 319
FbaI TGATCA 1 cut(s) 204
FblI GTMKAC 1 cut(s) 285
FokI GGATG 2 cut(s) 73, 314
FspBI CTAG 2 cut(s) 246, 375
Hin1II CATG 3 cut(s) 121, 238, 323
HinfI GANTC 2 cut(s) 19, 130
HphI GGTGA 1 cut(s) 214
Hpy166II GTNNAC 1 cut(s) 286
Hpy188III TCNNGA 2 cut(s) 127, 134
Hpy8I GTNNAC 1 cut(s) 286
HpyAV CCTTC 2 cut(s) 131, 143
HpyCH4IV ACGT 1 cut(s) 270
HpyCH4V TGCA 4 cut(s) 117, 179, 281, 319
HpyF3I CTNAG 1 cut(s) 258
HpySE526I ACGT 1 cut(s) 270
Hsp92II CATG 3 cut(s) 121, 238, 323
Ksp22I TGATCA 1 cut(s) 204
Kzo9I GATC 1 cut(s) 204
MabI ACCWGGT 1 cut(s) 198
MaeI CTAG 2 cut(s) 246, 375
MaeII ACGT 1 cut(s) 270
MalI GATC 1 cut(s) 206
MboI GATC 1 cut(s) 204
MluCI AATT 5 cut(s) 153, 170, 252, 368, 392
MnlI CCTC 1 cut(s) 43
MroXI GAANNNNTTC 1 cut(s) 153
MspR9I CCNGG 2 cut(s) 200, 294
MvaI CCWGG 2 cut(s) 200, 294
NcoI CCATGG 1 cut(s) 234
NdeII GATC 1 cut(s) 204
NlaIII CATG 3 cut(s) 121, 238, 323
NspI RCATGY 1 cut(s) 121
PdmI GAANNNNTTC 1 cut(s) 153
PfeI GAWTC 2 cut(s) 19, 130
PflMI CCANNNNNTGG 1 cut(s) 299
Psp6I CCWGG 2 cut(s) 198, 292
PspGI CCWGG 2 cut(s) 198, 292
RsaI GTAC 1 cut(s) 269
RsaNI GTAC 1 cut(s) 268
Sau3AI GATC 1 cut(s) 204
ScrFI CCNGG 2 cut(s) 200, 294
SetI ASST 7 cut(s) 142, 187, 204, 219, 273, 298, 388
SexAI ACCWGGT 1 cut(s) 198
SfcI CTRYAG 1 cut(s) 309
SpeI ACTAGT 1 cut(s) 374
Sse9I AATT 5 cut(s) 153, 170, 252, 368, 392
SspMI CTAG 2 cut(s) 246, 375
StyD4I CCNGG 2 cut(s) 198, 292
StyI CCWWGG 1 cut(s) 234
TaiI ACGT 1 cut(s) 273
TaqI TCGA 2 cut(s) 128, 351
TaqII GACCGA 1 cut(s) 65
TasI AATT 5 cut(s) 153, 170, 252, 368, 392
TfiI GAWTC 2 cut(s) 19, 130
TspDTI ATGAA 2 cut(s) 84, 316
Van91I CCANNNNNTGG 1 cut(s) 299
XapI RAATTY 2 cut(s) 153, 170
XceI RCATGY 1 cut(s) 121
XmiI GTMKAC 1 cut(s) 285
XmnI GAANNNNTTC 1 cut(s) 153
XspI CTAG 2 cut(s) 246, 375
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.