Rh6AG426300

Caffeoylshikimate esterase-like

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr6A
OG0031210
Physical Location & Seq
Forward (+)
61799573 .. 61799954
382 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh6AG426300.1

Sequence Viewer

Length: 270 bp
ATGGAAGGAATTCAAGGGGTATGGAAATTTTCTGCAAAAGCTGGTTGCCAAAACCAGGTGATCAAATCCAAGCTGGCTTATGTTTCTGCCATGGGTATTGCTAGGAGAATTGCTCAGTCTGGGTACTCTGTGTATGCAGTAGACTATCCAGGTTTTGGTCTTTCTGAAGGGTTGCATGGTTTCATCCCAGACTTTGATGAGTTGGTCGATGATGTTATTGAACAATTTACTAGTATCAAAGGTGTGAAATTGATTGGTAGAGTGGTCTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko00561 ko01100 ko04714 ko04723 ko04923 map00561 map01100 map04714 map04723 map04923
Pfam Domains
Protein Families
Hydrolase_4

Protein Analysis

89

Amino Acids

9.67

Weight (kDa)

6.54

Isoelectric Point (pI)

17.21

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Hydrolase_4 PF12146 33 - 80 2.1e-11 Serine aminopeptidase, S33
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0031210)

Species Orthologous Gene IDs
rosa_multiflora Rmu_sc0002417.1_g000002
rosa_samantha Rh6AG426300

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 155
AccI GTMKAC 1 cut(s) 141
AcsI RAATTY 2 cut(s) 9, 26
AcuI CTGAAG 1 cut(s) 186
AfaI GTAC 1 cut(s) 125
AfiI CCNNNNNNNGG 2 cut(s) 55, 155
AgsI TTSAA 2 cut(s) 14, 221
AhlI ACTAGT 1 cut(s) 230
AjnI CCWGG 2 cut(s) 54, 148
AluBI AGCT 2 cut(s) 41, 73
AluI AGCT 2 cut(s) 41, 73
ApoI RAATTY 2 cut(s) 9, 26
Asp700I GAANNNNTTC 1 cut(s) 9
AsuHPI GGTGA 1 cut(s) 70
BciT130I CCWGG 2 cut(s) 56, 150
BclI TGATCA 1 cut(s) 60
BcuI ACTAGT 1 cut(s) 230
BfaI CTAG 2 cut(s) 102, 231
Bme1390I CCNGG 2 cut(s) 56, 150
BmrFI CCNGG 2 cut(s) 56, 150
BplI GAGNNNNNCTC 2 cut(s) 97, 129
BsaJI CCNNGG 1 cut(s) 90
Bsc4I CCNNNNNNNGG 2 cut(s) 55, 155
BseBI CCWGG 2 cut(s) 56, 150
BseDI CCNNGG 1 cut(s) 90
BseGI GGATG 1 cut(s) 183
BseLI CCNNNNNNNGG 2 cut(s) 55, 155
BseMII CTCAG 1 cut(s) 128
BslI CCNNNNNNNGG 2 cut(s) 55, 155
Bsp143I GATC 1 cut(s) 60
Bsp19I CCATGG 1 cut(s) 90
BspCNI CTCAG 1 cut(s) 127
BssECI CCNNGG 1 cut(s) 90
BssMI GATC 1 cut(s) 60
BssT1I CCWWGG 1 cut(s) 90
Bst2UI CCWGG 2 cut(s) 56, 150
BstC8I GCNNGC 1 cut(s) 75
BstDEI CTNAG 1 cut(s) 114
BstDSI CCRYGG 1 cut(s) 90
BstF5I GGATG 1 cut(s) 183
BstKTI GATC 1 cut(s) 63
BstMBI GATC 1 cut(s) 60
BstNI CCWGG 2 cut(s) 56, 150
BstSCI CCNGG 2 cut(s) 54, 148
BtgI CCRYGG 1 cut(s) 90
BtsCI GGATG 1 cut(s) 183
Cac8I GCNNGC 1 cut(s) 75
CsiI ACCWGGT 1 cut(s) 54
Csp6I GTAC 1 cut(s) 124
CviAII CATG 2 cut(s) 91, 176
CviJI RGCY 3 cut(s) 41, 73, 77
CviKI_1 RGCY 3 cut(s) 41, 73, 77
CviQI GTAC 1 cut(s) 124
DdeI CTNAG 1 cut(s) 114
DpnI GATC 1 cut(s) 62
DpnII GATC 1 cut(s) 60
Eco130I CCWWGG 1 cut(s) 90
Eco57I CTGAAG 1 cut(s) 186
EcoRI GAATTC 1 cut(s) 9
EcoRII CCWGG 2 cut(s) 54, 148
EcoT14I CCWWGG 1 cut(s) 90
ErhI CCWWGG 1 cut(s) 90
FaeI CATG 2 cut(s) 94, 179
FaiI YATR 5 cut(s) 22, 81, 92, 135, 177
FatI CATG 2 cut(s) 90, 175
FbaI TGATCA 1 cut(s) 60
FblI GTMKAC 1 cut(s) 141
FokI GGATG 1 cut(s) 170
FspBI CTAG 2 cut(s) 102, 231
Hin1II CATG 2 cut(s) 94, 179
HphI GGTGA 1 cut(s) 70
Hpy166II GTNNAC 1 cut(s) 142
Hpy188I TCNGA 1 cut(s) 166
Hpy8I GTNNAC 1 cut(s) 142
HpyAV CCTTC 1 cut(s) 161
HpyCH4V TGCA 3 cut(s) 35, 137, 175
HpyF3I CTNAG 1 cut(s) 114
Hsp92II CATG 2 cut(s) 94, 179
Ksp22I TGATCA 1 cut(s) 60
Kzo9I GATC 1 cut(s) 60
LpnPI CCDG 8 cut(s) 27, 41, 59, 68, 105, 135, 162, 201
MabI ACCWGGT 1 cut(s) 54
MaeI CTAG 2 cut(s) 102, 231
MalI GATC 1 cut(s) 62
MboI GATC 1 cut(s) 60
MluCI AATT 5 cut(s) 9, 26, 108, 224, 248
MroXI GAANNNNTTC 1 cut(s) 9
MspR9I CCNGG 2 cut(s) 56, 150
MvaI CCWGG 2 cut(s) 56, 150
NcoI CCATGG 1 cut(s) 90
NdeII GATC 1 cut(s) 60
NlaIII CATG 2 cut(s) 94, 179
PdmI GAANNNNTTC 1 cut(s) 9
PflMI CCANNNNNTGG 1 cut(s) 155
Psp6I CCWGG 2 cut(s) 54, 148
PspGI CCWGG 2 cut(s) 54, 148
RsaI GTAC 1 cut(s) 125
RsaNI GTAC 1 cut(s) 124
Sau3AI GATC 1 cut(s) 60
ScrFI CCNGG 2 cut(s) 56, 150
SetI ASST 5 cut(s) 43, 60, 75, 154, 244
SexAI ACCWGGT 1 cut(s) 54
SpeI ACTAGT 1 cut(s) 230
Sse9I AATT 5 cut(s) 9, 26, 108, 224, 248
SspMI CTAG 2 cut(s) 102, 231
StyD4I CCNGG 2 cut(s) 54, 148
StyI CCWWGG 1 cut(s) 90
TaqI TCGA 1 cut(s) 207
TasI AATT 5 cut(s) 9, 26, 108, 224, 248
TspDTI ATGAA 1 cut(s) 172
Van91I CCANNNNNTGG 1 cut(s) 155
XapI RAATTY 2 cut(s) 9, 26
XmiI GTMKAC 1 cut(s) 141
XmnI GAANNNNTTC 1 cut(s) 9
XspI CTAG 2 cut(s) 102, 231
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.