Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0002438.1

Orthogroup ID

OG0023086

Physical Location & Seq

Genomic Coordinates Forward (+)

79076 .. 79852

Gene Structure 777 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0002438.1_g000019.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 351 bp

atggctcttaccaactcgaccacctgtggtggttacggtttcgtctacttgttcgaattggaaacgatgtctgtcggcagtggtctccagaactgccgcggcaaatttgatgccgacgccttacataataagaggtctgctcaattagatcttgatggtgctacaaatgaacttgtaatccgagtacagcctgatgaagctatctttctgaagtttaataacaaagtccctagtttcggaatgcggttggacaggacggatttgaatcttaattatgcagccagatattcaactgagattccagatgtgtgcgagatgtctcgagactgtttttctggagtgatgaactag

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0003674 GO:0003824 GO:0004345 GO:0005575 GO:0005622 GO:0005623 GO:0005737 GO:0005975 GO:0005996 GO:0006006 GO:0006081 GO:0006098 GO:0006139 GO:0006725 GO:0006732 GO:0006733 GO:0006739 GO:0006753 GO:0006793 GO:0006796 GO:0006807 GO:0008150 GO:0008152 GO:0009051 GO:0009117 GO:0009507 GO:0009532 GO:0009536 GO:0009570 GO:0009987 GO:0016491 GO:0016614 GO:0016616 GO:0019318 GO:0019362 GO:0019637 GO:0019682 GO:0019693 GO:0034641 GO:0043226 GO:0043227 GO:0043229 GO:0043231 GO:0044237 GO:0044238 GO:0044281 GO:0044422 GO:0044424 GO:0044434 GO:0044435 GO:0044444 GO:0044446 GO:0044464 GO:0046483 GO:0046496 GO:0051156 GO:0051186 GO:0055086 GO:0055114 GO:0071704 GO:0072524 GO:1901135 GO:1901360 GO:1901564

KEGG Pathways

Metabolic & Signaling

ko00030 ko00480 ko01100 ko01110 ko01120 ko01130 ko01200 ko05230 map00030 map00480 map01100 map01110 map01120 map01130 map01200 map05230

Pfam Domains

Protein Families

G6PD_C G6PD_N

Protein Analysis

116

Amino Acids

12.9

Weight (kDa)

4.83

Isoelectric Point (pI)

34.64

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0023086)

Species	Orthologous Gene IDs
rosa_multiflora	Rmu_sc0002438.1_g000019
rosa_samantha	Rh4AG198300 Rh4BG196300 Rh4DG196100

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccI	GTMKAC	1 cut(s)	45
AccII	CGCG	1 cut(s)	99
AciI	CCGC	3 cut(s)	97, 99, 244
AcsI	RAATTY	1 cut(s)	104
AcuI	CTGAAG	1 cut(s)	230
AcyI	GRCGYC	1 cut(s)	117
AfaI	GTAC	1 cut(s)	186
AfiI	CCNNNNNNNGG	1 cut(s)	236
AgsI	TTSAA	2 cut(s)	265, 291
AloI	GAACNNNNNNTCC	2 cut(s)	162, 194
AluBI	AGCT	1 cut(s)	200
AluI	AGCT	1 cut(s)	200
Alw26I	GTCTC	3 cut(s)	89, 318, 324
Ama87I	CYCGRG	1 cut(s)	321
ApeKI	GCWGC	1 cut(s)	278
ApoI	RAATTY	1 cut(s)	104
AsuII	TTCGAA	1 cut(s)	54
AvaI	CYCGRG	1 cut(s)	321
BbvI	GCAGC	1 cut(s)	290
BccI	CCATC	1 cut(s)	149
BcoDI	GTCTC	3 cut(s)	89, 318, 324
BfaI	CTAG	2 cut(s)	231, 349
BglII	AGATCT	1 cut(s)	148
BisI	GCNGC	3 cut(s)	97, 100, 279
BlsI	GCNGC	3 cut(s)	98, 101, 280
BmeT110I	CYCGRG	1 cut(s)	321
BmsI	GCATC	1 cut(s)	100
BplI	GAGNNNNNCTC	2 cut(s)	124, 156
BpmI	CTGGAG	1 cut(s)	71
Bpu14I	TTCGAA	1 cut(s)	54
BsaBI	GATNNNNATC	1 cut(s)	264
BsaHI	GRCGYC	1 cut(s)	117
BsaI	GGTCTC	1 cut(s)	89
BsaJI	CCNNGG	1 cut(s)	97
Bsc4I	CCNNNNNNNGG	1 cut(s)	236
Bse8I	GATNNNNATC	1 cut(s)	264
BseDI	CCNNGG	1 cut(s)	97
BseJI	GATNNNNATC	1 cut(s)	264
BseLI	CCNNNNNNNGG	1 cut(s)	236
BseMII	CTCAG	1 cut(s)	285
BseXI	GCAGC	1 cut(s)	290
Bsh1236I	CGCG	1 cut(s)	99
BsiHKCI	CYCGRG	1 cut(s)	321
BslFI	GGGAC	1 cut(s)	212
BslI	CCNNNNNNNGG	1 cut(s)	236
BsmAI	GTCTC	3 cut(s)	89, 318, 324
BsmFI	GGGAC	1 cut(s)	212
BsmI	GAATGC	1 cut(s)	246
Bso31I	GGTCTC	1 cut(s)	89
BsoBI	CYCGRG	1 cut(s)	321
Bsp119I	TTCGAA	1 cut(s)	54
Bsp143I	GATC	1 cut(s)	148
BspACI	CCGC	3 cut(s)	97, 99, 244
BspCNI	CTCAG	1 cut(s)	286
BspFNI	CGCG	1 cut(s)	99
BspT104I	TTCGAA	1 cut(s)	54
BspTNI	GGTCTC	1 cut(s)	89
BssECI	CCNNGG	1 cut(s)	97
BssMI	GATC	1 cut(s)	148
BssNI	GRCGYC	1 cut(s)	117
Bst4CI	ACNGT	2 cut(s)	38, 329
BstACI	GRCGYC	1 cut(s)	117
BstBI	TTCGAA	1 cut(s)	54
BstDEI	CTNAG	1 cut(s)	294
BstDSI	CCRYGG	1 cut(s)	97
BstFNI	CGCG	1 cut(s)	99
BstKTI	GATC	1 cut(s)	151
BstMAI	GTCTC	3 cut(s)	89, 318, 324
BstMBI	GATC	1 cut(s)	148
BstUI	CGCG	1 cut(s)	99
BstV1I	GCAGC	1 cut(s)	290
BstX2I	RGATCY	1 cut(s)	148
BstYI	RGATCY	1 cut(s)	148
BtgI	CCRYGG	1 cut(s)	97
BtsI	GCAGTG	1 cut(s)	85
BtsIMutI	CAGTG	1 cut(s)	85
Cfr42I	CCGCGG	1 cut(s)	100
CseI	GACGC	1 cut(s)	125
Csp6I	GTAC	1 cut(s)	185
CviJI	RGCY	4 cut(s)	5, 190, 200, 281
CviKI_1	RGCY	4 cut(s)	5, 190, 200, 281
CviQI	GTAC	1 cut(s)	185
DdeI	CTNAG	1 cut(s)	294
DpnI	GATC	1 cut(s)	150
DpnII	GATC	1 cut(s)	148
Eco31I	GGTCTC	1 cut(s)	89
Eco57I	CTGAAG	1 cut(s)	230
Eco88I	CYCGRG	1 cut(s)	321
FaiI	YATR	2 cut(s)	126, 276
FaqI	GGGAC	1 cut(s)	212
FblI	GTMKAC	1 cut(s)	45
Fnu4HI	GCNGC	3 cut(s)	97, 100, 279
Fsp4HI	GCNGC	3 cut(s)	97, 100, 279
FspBI	CTAG	2 cut(s)	231, 349
GluI	GCNGC	3 cut(s)	97, 100, 279
GsuI	CTGGAG	1 cut(s)	71
HgaI	GACGC	1 cut(s)	125
Hin1I	GRCGYC	1 cut(s)	117
HinfI	GANTC	2 cut(s)	265, 298
Hpy166II	GTNNAC	1 cut(s)	46
Hpy188I	TCNGA	3 cut(s)	182, 210, 239
Hpy188III	TCNNGA	6 cut(s)	88, 152, 302, 321, 323, 336
Hpy8I	GTNNAC	1 cut(s)	46
Hpy99I	CGWCG	1 cut(s)	119
HpyCH4III	ACNGT	2 cut(s)	38, 329
HpyCH4V	TGCA	1 cut(s)	278
HpyF3I	CTNAG	1 cut(s)	294
Hsp92I	GRCGYC	1 cut(s)	117
KspI	CCGCGG	1 cut(s)	100
Kzo9I	GATC	1 cut(s)	148
LpnPI	CCDG	7 cut(s)	37, 101, 204, 238, 295, 315, 321
Lsp1109I	GCAGC	1 cut(s)	290
LweI	GCATC	1 cut(s)	100
MaeI	CTAG	2 cut(s)	231, 349
MaeIII	GTNAC	1 cut(s)	32
MalI	GATC	1 cut(s)	150
MboI	GATC	1 cut(s)	148
MflI	RGATCY	1 cut(s)	148
MluCI	AATT	4 cut(s)	56, 104, 143, 271
MmeI	TCCRAC	1 cut(s)	228
MnlI	CCTC	1 cut(s)	126
MseI	TTAA	2 cut(s)	216, 270
MspA1I	CMGCKG	1 cut(s)	99
Mva1269I	GAATGC	1 cut(s)	246
MvnI	CGCG	1 cut(s)	99
NdeII	GATC	1 cut(s)	148
NspV	TTCGAA	1 cut(s)	54
PaeR7I	CTCGAG	1 cut(s)	321
PctI	GAATGC	1 cut(s)	246
PfeI	GAWTC	2 cut(s)	265, 298
PkrI	GCNGC	3 cut(s)	98, 101, 280
PsuI	RGATCY	1 cut(s)	148
RsaI	GTAC	1 cut(s)	186
RsaNI	GTAC	1 cut(s)	185
SacII	CCGCGG	1 cut(s)	100
SaqAI	TTAA	2 cut(s)	216, 270
SatI	GCNGC	3 cut(s)	97, 100, 279
Sau3AI	GATC	1 cut(s)	148
SetI	ASST	3 cut(s)	26, 137, 202
SfaNI	GCATC	1 cut(s)	100
Sfr274I	CTCGAG	1 cut(s)	321
Sfr303I	CCGCGG	1 cut(s)	100
SfuI	TTCGAA	1 cut(s)	54
SgrBI	CCGCGG	1 cut(s)	100
SlaI	CTCGAG	1 cut(s)	321
SmlI	CTYRAG	1 cut(s)	321
SmoI	CTYRAG	1 cut(s)	321
Sse9I	AATT	4 cut(s)	56, 104, 143, 271
SsiI	CCGC	3 cut(s)	97, 99, 244
SspMI	CTAG	2 cut(s)	231, 349
TaaI	ACNGT	2 cut(s)	38, 329
TaqI	TCGA	3 cut(s)	17, 54, 322
TasI	AATT	4 cut(s)	56, 104, 143, 271
TatI	WGTACW	1 cut(s)	184
TauI	GCSGC	2 cut(s)	99, 102
TfiI	GAWTC	2 cut(s)	265, 298
Tru1I	TTAA	2 cut(s)	216, 270
Tru9I	TTAA	2 cut(s)	216, 270
TscAI	CASTG	1 cut(s)	85
TseI	GCWGC	1 cut(s)	278
TspDTI	ATGAA	2 cut(s)	183, 210
TspGWI	ACGGA	1 cut(s)	272
TspRI	CASTG	1 cut(s)	85
XapI	RAATTY	1 cut(s)	104
XhoI	CTCGAG	1 cut(s)	321
XmiI	GTMKAC	1 cut(s)	45
XspI	CTAG	2 cut(s)	231, 349

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.