Rmu_sc0002531.1_g000016

Carotenoid 9,10(9',10')-cleavage dioxygenase

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0002531.1
OG0021172
Physical Location & Seq
Forward (+)
98968 .. 100422
1455 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 417 bp
atgtgccaaagtggagaggacaacaatgctaaattgaaaatcaaggttgcaaaagaaatgcaggcagagaagaaagggaaaattattgctgctattcttcttttagaggctttaggctttatcccagcttctgtatctttgggaagttccttggtatctgttttgtatctttttaacgtggttgaaatcaggaagcaacgctatgtgtatggaaccacactggatagcattgcaaaggtgacagggatagtcaagtttgatctgcatgctgcacctgaggttggaaaaacggaaattgaggttggagggaacgtccaaggcctttatgacctgggacctgatagatttggttctgaggctatttttgacccccccctgttcttggtattacttcagaagaagatgatggctacttga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
RPE65

Protein Analysis

138

Amino Acids

14.97

Weight (kDa)

7.79

Isoelectric Point (pI)

28.5

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0021172)

Species Orthologous Gene IDs
malus_domestica MD02G1309500.v1.1
rosa_chinensis RchiOBHm_Chr1g0344111
rosa_multiflora Rmu_sc0002531.1_g000016
rosa_roxburghii Rroxscaffold_3G00246000 Rroxscaffold_6G00396290

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcuI CTGAAG 1 cut(s) 377
AfiI CCNNNNNNNGG 2 cut(s) 281, 382
AgsI TTSAA 2 cut(s) 37, 185
AjnI CCWGG 1 cut(s) 330
AjuI GAANNNNNNNTTGG 2 cut(s) 285, 317
AluBI AGCT 1 cut(s) 128
AluI AGCT 1 cut(s) 128
AlwNI CAGNNNCTG 1 cut(s) 131
AoxI GGCC 1 cut(s) 319
ApeKI GCWGC 2 cut(s) 89, 269
AspS9I GGNCC 1 cut(s) 335
AsuHPI GGTGA 1 cut(s) 250
AvaII GGWCC 1 cut(s) 335
AxyI CCTNAGG 1 cut(s) 276
BbvI GCAGC 2 cut(s) 76, 256
BccI CCATC 1 cut(s) 400
BciT130I CCWGG 1 cut(s) 332
BisI GCNGC 2 cut(s) 90, 270
BlsI GCNGC 2 cut(s) 91, 271
Bme1390I CCNGG 1 cut(s) 332
Bme18I GGWCC 1 cut(s) 335
BmgT120I GGNCC 1 cut(s) 335
BmiI GGNNCC 2 cut(s) 214, 336
BmrFI CCNGG 1 cut(s) 332
BsaJI CCNNGG 3 cut(s) 150, 316, 331
BsaXI ACNNNNNCTCC 2 cut(s) 297, 327
Bsc4I CCNNNNNNNGG 2 cut(s) 281, 382
Bse1I ACTGG 1 cut(s) 225
Bse21I CCTNAGG 1 cut(s) 276
Bse3DI GCAATG 1 cut(s) 228
BseBI CCWGG 1 cut(s) 332
BseDI CCNNGG 3 cut(s) 150, 316, 331
BseLI CCNNNNNNNGG 2 cut(s) 281, 382
BseMI GCAATG 1 cut(s) 228
BseMII CTCAG 2 cut(s) 267, 345
BseNI ACTGG 1 cut(s) 225
BseXI GCAGC 2 cut(s) 76, 256
BseYI CCCAGC 1 cut(s) 124
BsgI GTGCAG 1 cut(s) 255
BshFI GGCC 1 cut(s) 321
BslFI GGGAC 1 cut(s) 348
BslI CCNNNNNNNGG 2 cut(s) 281, 382
BsmFI GGGAC 1 cut(s) 348
BsnI GGCC 1 cut(s) 321
Bsp143I GATC 1 cut(s) 259
BspANI GGCC 1 cut(s) 321
BspCNI CTCAG 2 cut(s) 268, 346
BspLI GGNNCC 2 cut(s) 214, 336
BsrDI GCAATG 1 cut(s) 228
BsrI ACTGG 1 cut(s) 225
BssECI CCNNGG 3 cut(s) 150, 316, 331
BssMI GATC 1 cut(s) 259
BssT1I CCWWGG 2 cut(s) 150, 316
Bst2UI CCWGG 1 cut(s) 332
BstC8I GCNNGC 2 cut(s) 63, 267
BstDEI CTNAG 2 cut(s) 276, 354
BstKTI GATC 1 cut(s) 262
BstMBI GATC 1 cut(s) 259
BstNI CCWGG 1 cut(s) 332
BstNSI RCATGY 1 cut(s) 269
BstSCI CCNGG 1 cut(s) 330
BstV1I GCAGC 2 cut(s) 76, 256
Bsu36I CCTNAGG 1 cut(s) 276
BsuRI GGCC 1 cut(s) 321
BtsIMutI CAGTG 1 cut(s) 218
Cac8I GCNNGC 2 cut(s) 63, 267
CaiI CAGNNNCTG 1 cut(s) 131
Cfr13I GGNCC 1 cut(s) 335
CviAII CATG 1 cut(s) 266
CviJI RGCY 6 cut(s) 110, 117, 128, 321, 359, 410
CviKI_1 RGCY 6 cut(s) 110, 117, 128, 321, 359, 410
DdeI CTNAG 2 cut(s) 276, 354
DpnI GATC 1 cut(s) 261
DpnII GATC 1 cut(s) 259
Eco130I CCWWGG 2 cut(s) 150, 316
Eco147I AGGCCT 1 cut(s) 321
Eco47I GGWCC 1 cut(s) 335
Eco57I CTGAAG 1 cut(s) 377
Eco81I CCTNAGG 1 cut(s) 276
EcoO109I RGGNCCY 1 cut(s) 335
EcoRII CCWGG 1 cut(s) 330
EcoT14I CCWWGG 2 cut(s) 150, 316
ErhI CCWWGG 2 cut(s) 150, 316
FaeI CATG 1 cut(s) 269
FaiI YATR 4 cut(s) 204, 210, 267, 327
FaqI GGGAC 1 cut(s) 348
FatI CATG 1 cut(s) 265
Fnu4HI GCNGC 2 cut(s) 90, 270
Fsp4HI GCNGC 2 cut(s) 90, 270
GluI GCNGC 2 cut(s) 90, 270
GsaI CCCAGC 1 cut(s) 128
HaeIII GGCC 1 cut(s) 321
Hin1II CATG 1 cut(s) 269
HphI GGTGA 1 cut(s) 250
Hpy188I TCNGA 2 cut(s) 355, 396
Hpy188III TCNNGA 1 cut(s) 190
HpyCH4IV ACGT 2 cut(s) 177, 312
HpyCH4V TGCA 5 cut(s) 50, 61, 233, 265, 272
HpyF3I CTNAG 2 cut(s) 276, 354
HpySE526I ACGT 2 cut(s) 177, 312
Hsp92II CATG 1 cut(s) 269
Kzo9I GATC 1 cut(s) 259
Lsp1109I GCAGC 2 cut(s) 76, 256
MaeII ACGT 2 cut(s) 177, 312
MaeIII GTNAC 1 cut(s) 238
MalI GATC 1 cut(s) 261
MboI GATC 1 cut(s) 259
MboII GAAGA 4 cut(s) 82, 89, 409, 412
MluCI AATT 3 cut(s) 32, 81, 294
MmeI TCCRAC 2 cut(s) 262, 283
MnlI CCTC 6 cut(s) 10, 100, 271, 292, 299, 349
MseI TTAA 1 cut(s) 174
MspR9I CCNGG 1 cut(s) 332
MvaI CCWGG 1 cut(s) 332
NdeII GATC 1 cut(s) 259
NlaIII CATG 1 cut(s) 269
NlaIV GGNNCC 2 cut(s) 214, 336
NmuCI GTSAC 1 cut(s) 238
NspI RCATGY 1 cut(s) 269
PaeI GCATGC 1 cut(s) 269
PceI AGGCCT 1 cut(s) 321
PkrI GCNGC 2 cut(s) 91, 271
PpuMI RGGWCCY 1 cut(s) 335
Psp5II RGGWCCY 1 cut(s) 335
Psp6I CCWGG 1 cut(s) 330
PspFI CCCAGC 1 cut(s) 124
PspGI CCWGG 1 cut(s) 330
PspN4I GGNNCC 2 cut(s) 214, 336
PspPI GGNCC 1 cut(s) 335
PspPPI RGGWCCY 1 cut(s) 335
PstNI CAGNNNCTG 1 cut(s) 131
SaqAI TTAA 1 cut(s) 174
SatI GCNGC 2 cut(s) 90, 270
Sau3AI GATC 1 cut(s) 259
Sau96I GGNCC 1 cut(s) 335
ScrFI CCNGG 1 cut(s) 332
SinI GGWCC 1 cut(s) 335
SphI GCATGC 1 cut(s) 269
Sse9I AATT 3 cut(s) 32, 81, 294
SseBI AGGCCT 1 cut(s) 321
StuI AGGCCT 1 cut(s) 321
StyD4I CCNGG 1 cut(s) 330
StyI CCWWGG 2 cut(s) 150, 316
TaiI ACGT 2 cut(s) 180, 315
TasI AATT 3 cut(s) 32, 81, 294
Tru1I TTAA 1 cut(s) 174
Tru9I TTAA 1 cut(s) 174
TscAI CASTG 1 cut(s) 225
TseFI GTSAC 1 cut(s) 238
TseI GCWGC 2 cut(s) 89, 269
Tsp45I GTSAC 1 cut(s) 238
TspGWI ACGGA 1 cut(s) 305
TspRI CASTG 1 cut(s) 225
VpaK11BI GGWCC 1 cut(s) 335
XceI RCATGY 1 cut(s) 269
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.