Rmu_sc0002571.1_g000009

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0002571.1
OG0025539
Physical Location & Seq
Reverse (-)
51683 .. 52499
817 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0002571.1_g000009.1.cds

Sequence Viewer

Length: 204 bp
atggaacctgcaaaaattgattggaaaaacttggaatggacattcatagaggacaaagcctacgagcagatcaacgcccccaagtggtttgatttcttgaaccctaatgacaacctcgtcgatgaccacgcctggttttgcactcccggtggtgaaacatggaatgcccaagagagtgatggagggcaggttttggagctttaa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

67

Amino Acids

7.83

Weight (kDa)

4.05

Isoelectric Point (pI)

34.17

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0025539)

Species Orthologous Gene IDs
rosa_multiflora Rmu_sc0002571.1_g000009
rosa_samantha Rh2AG185400 Rh2DG191600

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AasI GACNNNNNNGTC 1 cut(s) 116
Acc36I ACCTGC 2 cut(s) 16, 178
AfiI CCNNNNNNNGG 1 cut(s) 84
AgsI TTSAA 1 cut(s) 100
AjnI CCWGG 1 cut(s) 131
AluBI AGCT 1 cut(s) 199
AluI AGCT 1 cut(s) 199
AsuC2I CCSGG 1 cut(s) 147
AsuHPI GGTGA 1 cut(s) 164
BccI CCATC 1 cut(s) 173
BciT130I CCWGG 1 cut(s) 133
BcnI CCSGG 1 cut(s) 147
BfuAI ACCTGC 2 cut(s) 16, 178
Bme1390I CCNGG 2 cut(s) 133, 147
BmiI GGNNCC 1 cut(s) 6
BmrFI CCNGG 2 cut(s) 133, 147
BpuMI CCSGG 1 cut(s) 147
BsaXI ACNNNNNCTCC 2 cut(s) 174, 204
Bsc4I CCNNNNNNNGG 1 cut(s) 84
BseBI CCWGG 1 cut(s) 133
BseLI CCNNNNNNNGG 1 cut(s) 84
BsiSI CCGG 1 cut(s) 147
BslI CCNNNNNNNGG 1 cut(s) 84
BsmI GAATGC 1 cut(s) 169
Bsp143I GATC 1 cut(s) 69
BspLI GGNNCC 1 cut(s) 6
BspMI ACCTGC 2 cut(s) 16, 178
BssMI GATC 1 cut(s) 69
Bst2UI CCWGG 1 cut(s) 133
BstKTI GATC 1 cut(s) 72
BstMBI GATC 1 cut(s) 69
BstNI CCWGG 1 cut(s) 133
BstSCI CCNGG 2 cut(s) 131, 145
BveI ACCTGC 2 cut(s) 16, 178
CviAII CATG 1 cut(s) 159
CviJI RGCY 2 cut(s) 59, 199
CviKI_1 RGCY 2 cut(s) 59, 199
DpnI GATC 1 cut(s) 71
DpnII GATC 1 cut(s) 69
DrdI GACNNNNNNGTC 1 cut(s) 116
DseDI GACNNNNNNGTC 1 cut(s) 116
EcoRII CCWGG 1 cut(s) 131
FaeI CATG 1 cut(s) 162
FaiI YATR 2 cut(s) 47, 160
FatI CATG 1 cut(s) 158
HapII CCGG 1 cut(s) 147
Hin1II CATG 1 cut(s) 162
HpaII CCGG 1 cut(s) 147
HphI GGTGA 1 cut(s) 164
Hpy188III TCNNGA 1 cut(s) 97
Hpy99I CGWCG 1 cut(s) 122
HpyCH4V TGCA 2 cut(s) 11, 141
Hsp92II CATG 1 cut(s) 162
Kzo9I GATC 1 cut(s) 69
LmnI GCTCC 1 cut(s) 196
LpnPI CCDG 5 cut(s) 21, 118, 145, 160, 173
MalI GATC 1 cut(s) 71
MboI GATC 1 cut(s) 69
MluCI AATT 1 cut(s) 15
MnlI CCTC 3 cut(s) 43, 125, 176
MseI TTAA 1 cut(s) 202
MspI CCGG 1 cut(s) 147
MspR9I CCNGG 2 cut(s) 133, 147
Mva1269I GAATGC 1 cut(s) 169
MvaI CCWGG 1 cut(s) 133
NciI CCSGG 1 cut(s) 147
NdeII GATC 1 cut(s) 69
NlaIII CATG 1 cut(s) 162
NlaIV GGNNCC 1 cut(s) 6
PctI GAATGC 1 cut(s) 169
Psp6I CCWGG 1 cut(s) 131
PspGI CCWGG 1 cut(s) 131
PspN4I GGNNCC 1 cut(s) 6
SaqAI TTAA 1 cut(s) 202
Sau3AI GATC 1 cut(s) 69
ScrFI CCNGG 2 cut(s) 133, 147
SetI ASST 4 cut(s) 10, 117, 192, 201
Sse9I AATT 1 cut(s) 15
StyD4I CCNGG 2 cut(s) 131, 145
TaqI TCGA 1 cut(s) 120
TasI AATT 1 cut(s) 15
Tru1I TTAA 1 cut(s) 202
Tru9I TTAA 1 cut(s) 202
TspDTI ATGAA 1 cut(s) 34
XcmI CCANNNNNNNNNTGG 1 cut(s) 176
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.