Rmu_sc0002636.1_g000027
MYB Family

bHLH-MYC and R2R3-MYB transcription factors N-terminal

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0002636.1
OG0031218
Physical Location & Seq
Reverse (-)
113725 .. 113988
264 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0002636.1_g000027.1.cds

Sequence Viewer

Length: 264 bp
atgtcattgcagaccataactctgatagcaattagaggtgtagttcagttggtagcaattaacaaggtggttgaagacctgagctatgttgtggtgctcagaaagaagctaagctacattaagaacatccctggagttgttccgcctcacccatcatctccatcattgccctgcttcaagcttgaccctcatgtctatacatggcacaatttccaaggcatgggtactaatgaaggtcccaccgcatcaaagtaccacccatga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
bHLH-MYC_N

Protein Analysis

87

Amino Acids

9.64

Weight (kDa)

9.46

Isoelectric Point (pI)

39.61

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0031218)

Species Orthologous Gene IDs
rosa_multiflora Rmu_sc0002636.1_g000027
rosa_rugosa Rorug04G0025600

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AasI GACNNNNNNGTC 1 cut(s) 191
AccB7I CCANNNNNTGG 1 cut(s) 220
AciI CCGC 2 cut(s) 143, 243
AfaI GTAC 2 cut(s) 226, 254
AfiI CCNNNNNNNGG 1 cut(s) 220
AgsI TTSAA 2 cut(s) 74, 178
AjnI CCWGG 1 cut(s) 130
AluBI AGCT 4 cut(s) 84, 109, 114, 181
AluI AGCT 4 cut(s) 84, 109, 114, 181
Alw21I GWGCWC 1 cut(s) 99
AspS9I GGNCC 1 cut(s) 236
AsuHPI GGTGA 1 cut(s) 140
AvaII GGWCC 1 cut(s) 236
BarI GAAGNNNNNNTAC 2 cut(s) 98, 130
BbsI GAAGAC 1 cut(s) 81
Bbv12I GWGCWC 1 cut(s) 99
BccI CCATC 2 cut(s) 160, 169
BciT130I CCWGG 1 cut(s) 132
BlpI GCTNAGC 1 cut(s) 110
Bme1390I CCNGG 1 cut(s) 132
Bme18I GGWCC 1 cut(s) 236
BmgT120I GGNCC 1 cut(s) 236
BmiI GGNNCC 1 cut(s) 238
BmrFI CCNGG 1 cut(s) 132
BmsI GCATC 1 cut(s) 254
BpiI GAAGAC 1 cut(s) 81
BpmI CTGGAG 1 cut(s) 153
Bpu10I CCTNAGC 1 cut(s) 80
Bpu1102I GCTNAGC 1 cut(s) 110
BsaJI CCNNGG 2 cut(s) 130, 214
Bsc4I CCNNNNNNNGG 1 cut(s) 220
Bse3DI GCAATG 2 cut(s) 5, 164
BseBI CCWGG 1 cut(s) 132
BseDI CCNNGG 2 cut(s) 130, 214
BseGI GGATG 1 cut(s) 126
BseLI CCNNNNNNNGG 1 cut(s) 220
BseMI GCAATG 2 cut(s) 5, 164
BseMII CTCAG 2 cut(s) 71, 112
BsiHKAI GWGCWC 1 cut(s) 99
BslFI GGGAC 1 cut(s) 222
BslI CCNNNNNNNGG 1 cut(s) 220
BsmFI GGGAC 1 cut(s) 222
Bsp1286I GDGCHC 1 cut(s) 99
Bsp1720I GCTNAGC 1 cut(s) 110
BspACI CCGC 2 cut(s) 143, 243
BspCNI CTCAG 2 cut(s) 72, 111
BspLI GGNNCC 1 cut(s) 238
BsrDI GCAATG 2 cut(s) 5, 164
BssECI CCNNGG 2 cut(s) 130, 214
BssT1I CCWWGG 1 cut(s) 214
Bst2UI CCWGG 1 cut(s) 132
BstDEI CTNAG 3 cut(s) 80, 98, 110
BstF5I GGATG 1 cut(s) 126
BstNI CCWGG 1 cut(s) 132
BstSCI CCNGG 1 cut(s) 130
BstV2I GAAGAC 1 cut(s) 81
BtsCI GGATG 1 cut(s) 126
Cfr13I GGNCC 1 cut(s) 236
Csp6I GTAC 2 cut(s) 225, 253
CviAII CATG 4 cut(s) 191, 201, 220, 261
CviJI RGCY 4 cut(s) 84, 109, 114, 181
CviKI_1 RGCY 4 cut(s) 84, 109, 114, 181
CviQI GTAC 2 cut(s) 225, 253
DdeI CTNAG 3 cut(s) 80, 98, 110
DrdI GACNNNNNNGTC 1 cut(s) 191
DseDI GACNNNNNNGTC 1 cut(s) 191
EciI GGCGGA 1 cut(s) 132
Eco130I CCWWGG 1 cut(s) 214
Eco47I GGWCC 1 cut(s) 236
EcoO109I RGGNCCY 1 cut(s) 236
EcoRII CCWGG 1 cut(s) 130
EcoT14I CCWWGG 1 cut(s) 214
ErhI CCWWGG 1 cut(s) 214
FaeI CATG 4 cut(s) 194, 204, 223, 264
FaiI YATR 7 cut(s) 17, 87, 192, 198, 202, 221, 262
FaqI GGGAC 1 cut(s) 222
FatI CATG 4 cut(s) 190, 200, 219, 260
FokI GGATG 1 cut(s) 113
GsuI CTGGAG 1 cut(s) 153
Hin1II CATG 4 cut(s) 194, 204, 223, 264
HindIII AAGCTT 1 cut(s) 179
HphI GGTGA 1 cut(s) 140
Hpy188I TCNGA 2 cut(s) 24, 101
HpyAV CCTTC 1 cut(s) 227
HpyCH4V TGCA 1 cut(s) 10
HpyF3I CTNAG 3 cut(s) 80, 98, 110
Hsp92II CATG 4 cut(s) 194, 204, 223, 264
LpnPI CCDG 4 cut(s) 92, 117, 144, 184
LweI GCATC 1 cut(s) 254
MboII GAAGA 1 cut(s) 86
MhlI GDGCHC 1 cut(s) 99
MluCI AATT 3 cut(s) 30, 57, 208
MnlI CCTC 3 cut(s) 29, 156, 198
MseI TTAA 2 cut(s) 60, 120
MspR9I CCNGG 1 cut(s) 132
MvaI CCWGG 1 cut(s) 132
NlaIII CATG 4 cut(s) 194, 204, 223, 264
NlaIV GGNNCC 1 cut(s) 238
PflMI CCANNNNNTGG 1 cut(s) 220
PpuMI RGGWCCY 1 cut(s) 236
Psp5II RGGWCCY 1 cut(s) 236
Psp6I CCWGG 1 cut(s) 130
PspGI CCWGG 1 cut(s) 130
PspN4I GGNNCC 1 cut(s) 238
PspPI GGNCC 1 cut(s) 236
PspPPI RGGWCCY 1 cut(s) 236
RsaI GTAC 2 cut(s) 226, 254
RsaNI GTAC 2 cut(s) 225, 253
SaqAI TTAA 2 cut(s) 60, 120
Sau96I GGNCC 1 cut(s) 236
ScrFI CCNGG 1 cut(s) 132
SduI GDGCHC 1 cut(s) 99
SetI ASST 8 cut(s) 40, 69, 81, 86, 111, 116, 183, 238
SfaNI GCATC 1 cut(s) 254
SinI GGWCC 1 cut(s) 236
Sse9I AATT 3 cut(s) 30, 57, 208
SsiI CCGC 2 cut(s) 143, 243
StyD4I CCNGG 1 cut(s) 130
StyI CCWWGG 1 cut(s) 214
TasI AATT 3 cut(s) 30, 57, 208
Tru1I TTAA 2 cut(s) 60, 120
Tru9I TTAA 2 cut(s) 60, 120
TspDTI ATGAA 1 cut(s) 246
Van91I CCANNNNNTGG 1 cut(s) 220
VpaK11BI GGWCC 1 cut(s) 236
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.