Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0002727.1

Orthogroup ID

OG0029854

Physical Location & Seq

Genomic Coordinates Reverse (-)

6093 .. 9739

Gene Structure 3647 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0002727.1_g000002.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 495 bp

atgtcagctgaagctaaagtagaagtgcagattggagaagtgcagcgtgacgggtatctgtggagctgctgcagcggatctgctctgttcgccaaatctgatggcaccagcgatgattctcctcggcgacaggtcgtctggcgtctggatggatgcaggtcgggcttgcccaagcaacggagccagctgctgttcgattcacggcaatggaaacagttgcaggcagaggatccgagaggcggagaaggttggggttcaacagttgctgctggaatcaatgcttcgaattgtgattttgtggggagcaagacggaagtggatgatcctaccttgatctccaagcagcaactatttgcaagaattgttggtgggcttggtggtagagcagcagaggaagtgatctttggtgagccagaggtgacaacaggtgcagctggtgatttgcagcagattgttgctatcaaattcaagctgtttctgtttgttgctagttga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0003674 GO:0003824 GO:0004176 GO:0005575 GO:0005622 GO:0005623 GO:0005737 GO:0006091 GO:0006508 GO:0006807 GO:0006996 GO:0008150 GO:0008152 GO:0008233 GO:0008237 GO:0009056 GO:0009057 GO:0009314 GO:0009416 GO:0009507 GO:0009526 GO:0009534 GO:0009535 GO:0009536 GO:0009579 GO:0009628 GO:0009642 GO:0009644 GO:0009657 GO:0009658 GO:0009668 GO:0009719 GO:0009725 GO:0009735 GO:0009765 GO:0009892 GO:0009941 GO:0009987 GO:0010027 GO:0010033 GO:0010109 GO:0010205 GO:0010206 GO:0010304 GO:0015979 GO:0016020 GO:0016043 GO:0016462 GO:0016787 GO:0016817 GO:0016818 GO:0016887 GO:0017111 GO:0019222 GO:0019538 GO:0019684 GO:0022607 GO:0030091 GO:0030163 GO:0031323 GO:0031324 GO:0031967 GO:0031975 GO:0031976 GO:0031977 GO:0031984 GO:0034357 GO:0034622 GO:0042221 GO:0042548 GO:0042623 GO:0042651 GO:0043155 GO:0043170 GO:0043226 GO:0043227 GO:0043229 GO:0043231 GO:0043467 GO:0043933 GO:0044085 GO:0044237 GO:0044238 GO:0044248 GO:0044257 GO:0044260 GO:0044265 GO:0044267 GO:0044422 GO:0044424 GO:0044434 GO:0044435 GO:0044436 GO:0044444 GO:0044446 GO:0044464 GO:0048519 GO:0048523 GO:0048564 GO:0050789 GO:0050794 GO:0050896 GO:0055035 GO:0061024 GO:0065003 GO:0065007 GO:0070011 GO:0071704 GO:0071840 GO:0072593 GO:0140096 GO:1901564 GO:1901565 GO:1901575 GO:1905156

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

AAA FtsH_ext Peptidase_M41

Protein Analysis

164

Amino Acids

17.66

Weight (kDa)

5.05

Isoelectric Point (pI)

44.85

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0029854)

Species	Orthologous Gene IDs
rosa_chinensis	RchiOBHm_Chr2g0120591
rosa_multiflora	Rmu_sc0002727.1_g000002

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
Acc36I	ACCTGC	1 cut(s)	147
AccB1I	GGYRCC	1 cut(s)	104
AciI	CCGC	2 cut(s)	75, 240
AclWI	GGATC	4 cut(s)	85, 224, 237, 317
AcsI	RAATTY	1 cut(s)	464
AcuI	CTGAAG	1 cut(s)	30
AcyI	GRCGYC	1 cut(s)	142
AfiI	CCNNNNNNNGG	2 cut(s)	177, 239
AgsI	TTSAA	2 cut(s)	258, 469
AhdI	GACNNNNNGTC	1 cut(s)	134
AjuI	GAANNNNNNNTTGG	4 cut(s)	15, 47, 387, 419
AluBI	AGCT	6 cut(s)	8, 14, 66, 187, 434, 472
AluI	AGCT	6 cut(s)	8, 14, 66, 187, 434, 472
AlwI	GGATC	4 cut(s)	85, 224, 237, 317
AlwNI	CAGNNNCTG	2 cut(s)	190, 266
ApoI	RAATTY	1 cut(s)	464
AsuHPI	GGTGA	3 cut(s)	419, 430, 449
AsuII	TTCGAA	1 cut(s)	284
BamHI	GGATCC	1 cut(s)	229
BanI	GGYRCC	1 cut(s)	104
BccI	CCATC	2 cut(s)	95, 143
BceAI	ACGGC	1 cut(s)	218
BfaI	CTAG	1 cut(s)	489
BfmI	CTRYAG	1 cut(s)	70
BfuAI	ACCTGC	1 cut(s)	147
BmeRI	GACNNNNNGTC	1 cut(s)	134
BmiI	GGNNCC	3 cut(s)	106, 182, 231
BmsI	GCATC	1 cut(s)	143
Bpu14I	TTCGAA	1 cut(s)	284
BsaHI	GRCGYC	1 cut(s)	142
BsaJI	CCNNGG	1 cut(s)	122
Bsc4I	CCNNNNNNNGG	2 cut(s)	177, 239
Bse3DI	GCAATG	1 cut(s)	212
BseDI	CCNNGG	1 cut(s)	122
BseGI	GGATG	3 cut(s)	154, 158, 325
BseLI	CCNNNNNNNGG	2 cut(s)	177, 239
BseMI	GCAATG	1 cut(s)	212
BseRI	GAGGAG	1 cut(s)	111
BsgI	GTGCAG	3 cut(s)	47, 62, 450
BshNI	GGYRCC	1 cut(s)	104
BslI	CCNNNNNNNGG	2 cut(s)	177, 239
Bsp119I	TTCGAA	1 cut(s)	284
Bsp143I	GATC	5 cut(s)	77, 229, 322, 333, 399
BspACI	CCGC	2 cut(s)	75, 240
BspLI	GGNNCC	3 cut(s)	106, 182, 231
BspMAI	CTGCAG	1 cut(s)	74
BspMI	ACCTGC	1 cut(s)	147
BspPI	GGATC	4 cut(s)	85, 224, 237, 317
BspT104I	TTCGAA	1 cut(s)	284
BspT107I	GGYRCC	1 cut(s)	104
BsrDI	GCAATG	1 cut(s)	212
BssECI	CCNNGG	1 cut(s)	122
BssMI	GATC	5 cut(s)	77, 229, 322, 333, 399
BssNI	GRCGYC	1 cut(s)	142
Bst4CI	ACNGT	2 cut(s)	216, 262
BstACI	GRCGYC	1 cut(s)	142
BstBI	TTCGAA	1 cut(s)	284
BstC8I	GCNNGC	3 cut(s)	167, 185, 222
BstF5I	GGATG	3 cut(s)	154, 158, 325
BstKTI	GATC	5 cut(s)	80, 232, 325, 336, 402
BstMBI	GATC	5 cut(s)	77, 229, 322, 333, 399
BstMWI	GCNNNNNNNGC	3 cut(s)	72, 89, 162
BstSFI	CTRYAG	1 cut(s)	70
BstX2I	RGATCY	2 cut(s)	77, 229
BstYI	RGATCY	2 cut(s)	77, 229
BtgZI	GCGATG	1 cut(s)	126
BtsCI	GGATG	3 cut(s)	154, 158, 325
BveI	ACCTGC	1 cut(s)	147
Cac8I	GCNNGC	3 cut(s)	167, 185, 222
CaiI	CAGNNNCTG	2 cut(s)	190, 266
CseI	GACGC	1 cut(s)	131
DpnI	GATC	5 cut(s)	79, 231, 324, 335, 401
DpnII	GATC	5 cut(s)	77, 229, 322, 333, 399
DriI	GACNNNNNGTC	1 cut(s)	134
Eam1105I	GACNNNNNGTC	1 cut(s)	134
EciI	GGCGGA	1 cut(s)	255
Eco57I	CTGAAG	1 cut(s)	30
FokI	GGATG	3 cut(s)	161, 165, 332
FspBI	CTAG	1 cut(s)	489
HgaI	GACGC	1 cut(s)	131
Hin1I	GRCGYC	1 cut(s)	142
HinfI	GANTC	3 cut(s)	116, 197, 273
HphI	GGTGA	3 cut(s)	419, 430, 449
Hpy188I	TCNGA	2 cut(s)	100, 234
Hpy188III	TCNNGA	1 cut(s)	146
HpyAV	CCTTC	1 cut(s)	239
HpyCH4III	ACNGT	2 cut(s)	216, 262
HpyCH4V	TGCA	8 cut(s)	28, 43, 72, 156, 220, 356, 431, 445
HpyF10VI	GCNNNNNNNGC	3 cut(s)	72, 89, 162
Hsp92I	GRCGYC	1 cut(s)	142
Kzo9I	GATC	5 cut(s)	77, 229, 322, 333, 399
LmnI	GCTCC	3 cut(s)	63, 180, 303
LweI	GCATC	1 cut(s)	143
MaeI	CTAG	1 cut(s)	489
MaeIII	GTNAC	2 cut(s)	47, 418
MalI	GATC	5 cut(s)	79, 231, 324, 335, 401
MboI	GATC	5 cut(s)	77, 229, 322, 333, 399
MflI	RGATCY	2 cut(s)	77, 229
MluCI	AATT	3 cut(s)	286, 360, 464
MnlI	CCTC	5 cut(s)	132, 220, 230, 385, 409
MslI	CAYNNNNRTG	1 cut(s)	205
MspA1I	CMGCKG	4 cut(s)	8, 75, 187, 434
MwoI	GCNNNNNNNGC	3 cut(s)	72, 89, 162
NdeII	GATC	5 cut(s)	77, 229, 322, 333, 399
NlaIV	GGNNCC	3 cut(s)	106, 182, 231
NmeAIII	GCCGAG	1 cut(s)	103
NmuCI	GTSAC	2 cut(s)	47, 418
NspV	TTCGAA	1 cut(s)	284
PfeI	GAWTC	3 cut(s)	116, 197, 273
PspN4I	GGNNCC	3 cut(s)	106, 182, 231
PstI	CTGCAG	1 cut(s)	74
PstNI	CAGNNNCTG	2 cut(s)	190, 266
PsuI	RGATCY	2 cut(s)	77, 229
PvuII	CAGCTG	3 cut(s)	8, 187, 434
RseI	CAYNNNNRTG	1 cut(s)	205
Sau3AI	GATC	5 cut(s)	77, 229, 322, 333, 399
SfaNI	GCATC	1 cut(s)	143
SfcI	CTRYAG	1 cut(s)	70
SfuI	TTCGAA	1 cut(s)	284
SmiMI	CAYNNNNRTG	1 cut(s)	205
Sse9I	AATT	3 cut(s)	286, 360, 464
SsiI	CCGC	2 cut(s)	75, 240
SspMI	CTAG	1 cut(s)	489
TaaI	ACNGT	2 cut(s)	216, 262
TaqI	TCGA	2 cut(s)	195, 284
TasI	AATT	3 cut(s)	286, 360, 464
TfiI	GAWTC	3 cut(s)	116, 197, 273
TseFI	GTSAC	2 cut(s)	47, 418
Tsp45I	GTSAC	2 cut(s)	47, 418
TspGWI	ACGGA	2 cut(s)	193, 326
XapI	RAATTY	1 cut(s)	464
XspI	CTAG	1 cut(s)	489

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.