Rmu_sc0003116.1_g000047

Peptidase inhibitor I9

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0003116.1
OG0030821
Physical Location & Seq
Forward (+)
253188 .. 253661
474 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0003116.1_g000047.1.cds

Sequence Viewer

Length: 348 bp
atggtctatatatggcctagttcgaatttcagtgacgacatgaccatctgttttattgatagcgggatttggccagaagcgaaattaagcttcaaagacgatgggatgcccgccaaatttccacctaggtggaaggctacatgcgaggttggacatgatttcaacacttccatgtgttatgtgaactatgtacccggtgcatctttttttggttatgctaaaggaatagccagaggtgttgcacttcgtgctagactagccgtctacaagtcacatgggaagaggggcattacgtgtcctatgttcttgccgggatggaccaagcaattgaagacgatgtgggtgtaa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Inhibitor_I9 Peptidase_S8

Protein Analysis

115

Amino Acids

13.0

Weight (kDa)

9.3

Isoelectric Point (pI)

26.31

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0030821)

Species Orthologous Gene IDs
rosa_laevigata RLG00000025893
rosa_multiflora Rmu_sc0003116.1_g000047

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 264
AciI CCGC 2 cut(s) 63, 111
AcoI YGGCCR 1 cut(s) 71
AcsI RAATTY 2 cut(s) 25, 116
AdeI CACNNNGTG 1 cut(s) 248
AfaI GTAC 1 cut(s) 192
AflIII ACRYGT 1 cut(s) 293
AgsI TTSAA 3 cut(s) 94, 163, 331
AhdI GACNNNNNGTC 1 cut(s) 260
AleI CACNNNNGTG 1 cut(s) 127
AluBI AGCT 1 cut(s) 90
AluI AGCT 1 cut(s) 90
AoxI GGCC 2 cut(s) 14, 71
ApoI RAATTY 2 cut(s) 25, 116
AspA2I CCTAGG 1 cut(s) 125
AspS9I GGNCC 1 cut(s) 318
AsuC2I CCSGG 2 cut(s) 195, 312
AsuII TTCGAA 1 cut(s) 23
AvaII GGWCC 1 cut(s) 318
AvrII CCTAGG 1 cut(s) 125
BalI TGGCCA 1 cut(s) 73
BbsI GAAGAC 1 cut(s) 338
BccI CCATC 3 cut(s) 53, 95, 309
BceAI ACGGC 1 cut(s) 245
BcnI CCSGG 2 cut(s) 195, 312
BfaI CTAG 4 cut(s) 18, 126, 252, 257
BlnI CCTAGG 1 cut(s) 125
Bme1390I CCNGG 2 cut(s) 195, 312
Bme18I GGWCC 1 cut(s) 318
BmeRI GACNNNNNGTC 1 cut(s) 260
BmgT120I GGNCC 1 cut(s) 318
BmrFI CCNGG 2 cut(s) 195, 312
BmsI GCATC 2 cut(s) 96, 209
BpiI GAAGAC 1 cut(s) 338
Bpu14I TTCGAA 1 cut(s) 23
BpuMI CCSGG 2 cut(s) 195, 312
BsaAI YACGTR 1 cut(s) 294
BsaJI CCNNGG 1 cut(s) 125
BseDI CCNNGG 1 cut(s) 125
BseGI GGATG 2 cut(s) 111, 320
BshFI GGCC 2 cut(s) 16, 73
BsiSI CCGG 2 cut(s) 195, 311
BsnI GGCC 2 cut(s) 16, 73
Bsp119I TTCGAA 1 cut(s) 23
BspACI CCGC 2 cut(s) 63, 111
BspANI GGCC 2 cut(s) 16, 73
BspT104I TTCGAA 1 cut(s) 23
BssECI CCNNGG 1 cut(s) 125
BssT1I CCWWGG 1 cut(s) 125
Bst6I CTCTTC 1 cut(s) 275
BstAPI GCANNNNNTGC 1 cut(s) 248
BstBAI YACGTR 1 cut(s) 294
BstBI TTCGAA 1 cut(s) 23
BstC8I GCNNGC 1 cut(s) 111
BstF5I GGATG 2 cut(s) 111, 320
BstMWI GCNNNNNNNGC 2 cut(s) 248, 257
BstNSI RCATGY 1 cut(s) 144
BstSCI CCNGG 2 cut(s) 193, 310
BstV2I GAAGAC 1 cut(s) 338
BstXI CCANNNNNNTGG 1 cut(s) 129
BsuRI GGCC 2 cut(s) 16, 73
BtsCI GGATG 2 cut(s) 111, 320
BtsIMutI CAGTG 1 cut(s) 37
Cac8I GCNNGC 1 cut(s) 111
Cfr13I GGNCC 1 cut(s) 318
Csp6I GTAC 1 cut(s) 191
CviAII CATG 5 cut(s) 40, 141, 155, 172, 275
CviJI RGCY 6 cut(s) 16, 73, 90, 137, 230, 260
CviKI_1 RGCY 6 cut(s) 16, 73, 90, 137, 230, 260
CviQI GTAC 1 cut(s) 191
DraIII CACNNNGTG 1 cut(s) 248
DriI GACNNNNNGTC 1 cut(s) 260
EaeI YGGCCR 1 cut(s) 71
Eam1104I CTCTTC 1 cut(s) 275
Eam1105I GACNNNNNGTC 1 cut(s) 260
EarI CTCTTC 1 cut(s) 275
Eco130I CCWWGG 1 cut(s) 125
Eco47I GGWCC 1 cut(s) 318
EcoT14I CCWWGG 1 cut(s) 125
ErhI CCWWGG 1 cut(s) 125
FaeI CATG 5 cut(s) 43, 144, 158, 175, 278
FatI CATG 5 cut(s) 39, 140, 154, 171, 274
FauI CCCGC 2 cut(s) 56, 118
FblI GTMKAC 1 cut(s) 264
FokI GGATG 2 cut(s) 118, 327
FspBI CTAG 4 cut(s) 18, 126, 252, 257
HaeIII GGCC 2 cut(s) 16, 73
HapII CCGG 2 cut(s) 195, 311
Hin1II CATG 5 cut(s) 43, 144, 158, 175, 278
HindIII AAGCTT 1 cut(s) 88
HpaII CCGG 2 cut(s) 195, 311
Hpy166II GTNNAC 2 cut(s) 184, 265
Hpy8I GTNNAC 2 cut(s) 184, 265
HpyAV CCTTC 1 cut(s) 127
HpyCH4IV ACGT 1 cut(s) 293
HpyCH4V TGCA 2 cut(s) 200, 242
HpyF10VI GCNNNNNNNGC 2 cut(s) 248, 257
HpySE526I ACGT 1 cut(s) 293
Hsp92II CATG 5 cut(s) 43, 144, 158, 175, 278
LpnPI CCDG 4 cut(s) 87, 208, 244, 324
LweI GCATC 2 cut(s) 96, 209
MaeI CTAG 4 cut(s) 18, 126, 252, 257
MaeII ACGT 1 cut(s) 293
MaeIII GTNAC 2 cut(s) 32, 270
MboII GAAGA 2 cut(s) 292, 343
MfeI CAATTG 1 cut(s) 326
MlsI TGGCCA 1 cut(s) 73
MluCI AATT 4 cut(s) 25, 83, 116, 326
MluNI TGGCCA 1 cut(s) 73
MmeI TCCRAC 1 cut(s) 130
MnlI CCTC 3 cut(s) 139, 227, 276
Mox20I TGGCCA 1 cut(s) 73
MscI TGGCCA 1 cut(s) 73
MseI TTAA 1 cut(s) 86
MslI CAYNNNNRTG 2 cut(s) 127, 170
Msp20I TGGCCA 1 cut(s) 73
MspI CCGG 2 cut(s) 195, 311
MspR9I CCNGG 2 cut(s) 195, 312
MunI CAATTG 1 cut(s) 326
MwoI GCNNNNNNNGC 2 cut(s) 248, 257
NciI CCSGG 2 cut(s) 195, 312
NlaIII CATG 5 cut(s) 43, 144, 158, 175, 278
NmuCI GTSAC 2 cut(s) 32, 270
NspI RCATGY 1 cut(s) 144
NspV TTCGAA 1 cut(s) 23
OliI CACNNNNGTG 1 cut(s) 127
Ppu21I YACGTR 1 cut(s) 294
PspPI GGNCC 1 cut(s) 318
RsaI GTAC 1 cut(s) 192
RsaNI GTAC 1 cut(s) 191
RseI CAYNNNNRTG 2 cut(s) 127, 170
SaqAI TTAA 1 cut(s) 86
Sau96I GGNCC 1 cut(s) 318
ScrFI CCNGG 2 cut(s) 195, 312
SetI ASST 6 cut(s) 92, 127, 131, 150, 238, 296
SfaNI GCATC 2 cut(s) 96, 209
SfuI TTCGAA 1 cut(s) 23
SinI GGWCC 1 cut(s) 318
SmiMI CAYNNNNRTG 2 cut(s) 127, 170
Sse9I AATT 4 cut(s) 25, 83, 116, 326
SsiI CCGC 2 cut(s) 63, 111
SspMI CTAG 4 cut(s) 18, 126, 252, 257
StyD4I CCNGG 2 cut(s) 193, 310
StyI CCWWGG 1 cut(s) 125
TaiI ACGT 1 cut(s) 296
TaqI TCGA 1 cut(s) 23
TasI AATT 4 cut(s) 25, 83, 116, 326
Tru1I TTAA 1 cut(s) 86
Tru9I TTAA 1 cut(s) 86
TscAI CASTG 1 cut(s) 37
TseFI GTSAC 2 cut(s) 32, 270
Tsp45I GTSAC 2 cut(s) 32, 270
TspRI CASTG 1 cut(s) 37
VpaK11BI GGWCC 1 cut(s) 318
XapI RAATTY 2 cut(s) 25, 116
XceI RCATGY 1 cut(s) 144
XmaJI CCTAGG 1 cut(s) 125
XmiI GTMKAC 1 cut(s) 264
XspI CTAG 4 cut(s) 18, 126, 252, 257
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.