Rmu_sc0003919.1_g000023

Catalyzes the phosphorylation of pyrimidine nucleoside monophosphates at the expense of ATP. Plays an important role in de novo pyrimidine nucleotide biosynthesis. Has preference for UMP and CMP as phosphate acceptors

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0003919.1
OG0025573
Physical Location & Seq
Forward (+)
122672 .. 123756
1085 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 240 bp
atgggaacagttgttaacgctgccaacaaggaggctaatcgaagctttgccgatctgaatcctactgttgttttcgtcttgggtggcccaggcagtggaaagggtacccaatgcgcaaacattgttcagcactttgggtttacacatctgagtgctggtgatctactacgagcagaaatcaagtctggttctgaaaatgggtatggcttagctttatattatgtaccaggtttcatttga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko00240 ko00983 ko01100 map00240 map00983 map01100
Pfam Domains
Protein Families
ADK

Protein Analysis

79

Amino Acids

8.22

Weight (kDa)

6.7

Isoelectric Point (pI)

21.71

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
ADK PF00406 26 - 69 6.6e-17 Adenylate kinase
AAA_17 PF13207 27 - 63 1.1e-15 AAA domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0025573)

Species Orthologous Gene IDs
rosa_multiflora Rmu_sc0003919.1_g000023 Rmu_sc0006244.1_g000055
rosa_samantha Rh3DG288500

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc16I TGCGCA 1 cut(s) 115
Acc65I GGTACC 1 cut(s) 104
AccB1I GGYRCC 1 cut(s) 104
AccB7I CCANNNNNTGG 1 cut(s) 95
AfaI GTAC 2 cut(s) 106, 225
AfiI CCNNNNNNNGG 1 cut(s) 95
AjnI CCWGG 2 cut(s) 88, 226
AluBI AGCT 2 cut(s) 45, 212
AluI AGCT 2 cut(s) 45, 212
AoxI GGCC 1 cut(s) 85
ApeKI GCWGC 1 cut(s) 20
Asp718I GGTACC 1 cut(s) 104
AspLEI GCGC 1 cut(s) 116
AspS9I GGNCC 1 cut(s) 86
AsuHPI GGTGA 1 cut(s) 170
BanI GGYRCC 1 cut(s) 104
BbvI GCAGC 1 cut(s) 7
BciT130I CCWGG 2 cut(s) 90, 228
BisI GCNGC 1 cut(s) 21
BlpI GCTNAGC 1 cut(s) 208
BlsI GCNGC 1 cut(s) 22
Bme1390I CCNGG 2 cut(s) 90, 228
BmgT120I GGNCC 1 cut(s) 86
BmiI GGNNCC 1 cut(s) 106
BmrFI CCNGG 2 cut(s) 90, 228
Bpu1102I GCTNAGC 1 cut(s) 208
BsaBI GATNNNNATC 1 cut(s) 57
BsaJI CCNNGG 1 cut(s) 88
Bsc4I CCNNNNNNNGG 1 cut(s) 95
Bse8I GATNNNNATC 1 cut(s) 57
BseBI CCWGG 2 cut(s) 90, 228
BseDI CCNNGG 1 cut(s) 88
BseJI GATNNNNATC 1 cut(s) 57
BseLI CCNNNNNNNGG 1 cut(s) 95
BseMII CTCAG 1 cut(s) 140
BseXI GCAGC 1 cut(s) 7
BshFI GGCC 1 cut(s) 87
BshNI GGYRCC 1 cut(s) 104
BslI CCNNNNNNNGG 1 cut(s) 95
BsnI GGCC 1 cut(s) 87
Bsp143I GATC 2 cut(s) 52, 160
Bsp1720I GCTNAGC 1 cut(s) 208
BspANI GGCC 1 cut(s) 87
BspCNI CTCAG 1 cut(s) 141
BspLI GGNNCC 1 cut(s) 106
BspT107I GGYRCC 1 cut(s) 104
BssECI CCNNGG 1 cut(s) 88
BssMI GATC 2 cut(s) 52, 160
Bst2UI CCWGG 2 cut(s) 90, 228
Bst4CI ACNGT 2 cut(s) 10, 67
BstDEI CTNAG 2 cut(s) 149, 208
BstHHI GCGC 1 cut(s) 116
BstKTI GATC 2 cut(s) 55, 163
BstMBI GATC 2 cut(s) 52, 160
BstNI CCWGG 2 cut(s) 90, 228
BstSCI CCNGG 2 cut(s) 88, 226
BstV1I GCAGC 1 cut(s) 7
BsuRI GGCC 1 cut(s) 87
BtsI GCAGTG 1 cut(s) 100
BtsIMutI CAGTG 1 cut(s) 100
CfoI GCGC 1 cut(s) 116
Cfr13I GGNCC 1 cut(s) 86
CsiI ACCWGGT 1 cut(s) 226
Csp6I GTAC 2 cut(s) 105, 224
CviJI RGCY 5 cut(s) 35, 45, 87, 207, 212
CviKI_1 RGCY 5 cut(s) 35, 45, 87, 207, 212
CviQI GTAC 2 cut(s) 105, 224
DdeI CTNAG 2 cut(s) 149, 208
DpnI GATC 2 cut(s) 54, 162
DpnII GATC 2 cut(s) 52, 160
EcoRII CCWGG 2 cut(s) 88, 226
FaiI YATR 3 cut(s) 204, 217, 222
Fnu4HI GCNGC 1 cut(s) 21
Fsp4HI GCNGC 1 cut(s) 21
FspI TGCGCA 1 cut(s) 115
GlaI GCGC 1 cut(s) 115
GluI GCNGC 1 cut(s) 21
HaeIII GGCC 1 cut(s) 87
HhaI GCGC 1 cut(s) 116
Hin6I GCGC 1 cut(s) 114
HinP1I GCGC 1 cut(s) 114
HincII GTYRAC 1 cut(s) 16
HindII GTYRAC 1 cut(s) 16
HindIII AAGCTT 1 cut(s) 43
HinfI GANTC 1 cut(s) 58
HpaI GTTAAC 1 cut(s) 16
HphI GGTGA 1 cut(s) 170
Hpy166II GTNNAC 2 cut(s) 16, 141
Hpy188I TCNGA 3 cut(s) 57, 150, 193
Hpy8I GTNNAC 2 cut(s) 16, 141
HpyCH4III ACNGT 2 cut(s) 10, 67
HpyF3I CTNAG 2 cut(s) 149, 208
HspAI GCGC 1 cut(s) 114
KpnI GGTACC 1 cut(s) 108
KspAI GTTAAC 1 cut(s) 16
Kzo9I GATC 2 cut(s) 52, 160
LpnPI CCDG 5 cut(s) 75, 102, 141, 171, 213
Lsp1109I GCAGC 1 cut(s) 7
MabI ACCWGGT 1 cut(s) 226
MalI GATC 2 cut(s) 54, 162
MboI GATC 2 cut(s) 52, 160
MnlI CCTC 1 cut(s) 25
MseI TTAA 1 cut(s) 15
MslI CAYNNNNRTG 1 cut(s) 150
MspR9I CCNGG 2 cut(s) 90, 228
MvaI CCWGG 2 cut(s) 90, 228
NdeII GATC 2 cut(s) 52, 160
NlaIV GGNNCC 1 cut(s) 106
NsbI TGCGCA 1 cut(s) 115
PfeI GAWTC 1 cut(s) 58
PflMI CCANNNNNTGG 1 cut(s) 95
PkrI GCNGC 1 cut(s) 22
Psp6I CCWGG 2 cut(s) 88, 226
PspGI CCWGG 2 cut(s) 88, 226
PspN4I GGNNCC 1 cut(s) 106
PspPI GGNCC 1 cut(s) 86
RsaI GTAC 2 cut(s) 106, 225
RsaNI GTAC 2 cut(s) 105, 224
RseI CAYNNNNRTG 1 cut(s) 150
SaqAI TTAA 1 cut(s) 15
SatI GCNGC 1 cut(s) 21
Sau3AI GATC 2 cut(s) 52, 160
Sau96I GGNCC 1 cut(s) 86
ScrFI CCNGG 2 cut(s) 90, 228
SetI ASST 3 cut(s) 47, 214, 232
SexAI ACCWGGT 1 cut(s) 226
SgeI CNNG 8 cut(s) 40, 91, 101, 102, 168, 182, 193, 198
SmiMI CAYNNNNRTG 1 cut(s) 150
StyD4I CCNGG 2 cut(s) 88, 226
TaaI ACNGT 2 cut(s) 10, 67
TaqI TCGA 1 cut(s) 40
TfiI GAWTC 1 cut(s) 58
Tru1I TTAA 1 cut(s) 15
Tru9I TTAA 1 cut(s) 15
TscAI CASTG 1 cut(s) 100
TseI GCWGC 1 cut(s) 20
TspDTI ATGAA 1 cut(s) 223
TspRI CASTG 1 cut(s) 100
Van91I CCANNNNNTGG 1 cut(s) 95
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.