Rmu_sc0006244.1_g000055

Catalyzes the phosphorylation of pyrimidine nucleoside monophosphates at the expense of ATP. Plays an important role in de novo pyrimidine nucleotide biosynthesis. Has preference for UMP and CMP as phosphate acceptors

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0006244.1
OG0025573
Physical Location & Seq
Reverse (-)
207808 .. 208610
803 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0006244.1_g000055.1.cds

Sequence Viewer

Length: 243 bp
atgtttacacgtgaaaacttaatcctcttgcagggggctaatcgaagctttgccgatctgaatcctactgttgttttcgtcttgggtggcccaggcagtggaaagggtacccaatgcgcaaacattgttcagcactttgggtttacacatctgagtgctggtgatctactacgagcagaaatcaagtctggttctgaaaatgggtatggcttagctttatattatgtaccaggtttcatttga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko00240 ko00983 ko01100 map00240 map00983 map01100
Pfam Domains
Protein Families
ADK

Protein Analysis

80

Amino Acids

8.52

Weight (kDa)

6.7

Isoelectric Point (pI)

25.09

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0025573)

Species Orthologous Gene IDs
rosa_multiflora Rmu_sc0003919.1_g000023 Rmu_sc0006244.1_g000055
rosa_samantha Rh3DG288500

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc16I TGCGCA 1 cut(s) 118
Acc65I GGTACC 1 cut(s) 107
AccB1I GGYRCC 1 cut(s) 107
AccB7I CCANNNNNTGG 1 cut(s) 98
AcvI CACGTG 1 cut(s) 11
AfaI GTAC 2 cut(s) 109, 228
AfiI CCNNNNNNNGG 2 cut(s) 31, 98
AflIII ACRYGT 1 cut(s) 8
AjnI CCWGG 2 cut(s) 91, 229
AluBI AGCT 2 cut(s) 48, 215
AluI AGCT 2 cut(s) 48, 215
AoxI GGCC 1 cut(s) 88
Asp718I GGTACC 1 cut(s) 107
AspLEI GCGC 1 cut(s) 119
AspS9I GGNCC 1 cut(s) 89
AsuHPI GGTGA 1 cut(s) 173
BanI GGYRCC 1 cut(s) 107
BbrPI CACGTG 1 cut(s) 11
BciT130I CCWGG 2 cut(s) 93, 231
BlpI GCTNAGC 1 cut(s) 211
Bme1390I CCNGG 2 cut(s) 93, 231
BmgT120I GGNCC 1 cut(s) 89
BmiI GGNNCC 1 cut(s) 109
BmrFI CCNGG 2 cut(s) 93, 231
Bpu1102I GCTNAGC 1 cut(s) 211
BsaAI YACGTR 1 cut(s) 11
BsaBI GATNNNNATC 1 cut(s) 60
BsaJI CCNNGG 1 cut(s) 91
Bsc4I CCNNNNNNNGG 2 cut(s) 31, 98
Bse8I GATNNNNATC 1 cut(s) 60
BseBI CCWGG 2 cut(s) 93, 231
BseDI CCNNGG 1 cut(s) 91
BseJI GATNNNNATC 1 cut(s) 60
BseLI CCNNNNNNNGG 2 cut(s) 31, 98
BseMII CTCAG 1 cut(s) 143
BshFI GGCC 1 cut(s) 90
BshNI GGYRCC 1 cut(s) 107
BslI CCNNNNNNNGG 2 cut(s) 31, 98
BsnI GGCC 1 cut(s) 90
Bsp143I GATC 2 cut(s) 55, 163
Bsp1720I GCTNAGC 1 cut(s) 211
BspANI GGCC 1 cut(s) 90
BspCNI CTCAG 1 cut(s) 144
BspLI GGNNCC 1 cut(s) 109
BspT107I GGYRCC 1 cut(s) 107
BssECI CCNNGG 1 cut(s) 91
BssMI GATC 2 cut(s) 55, 163
Bst2UI CCWGG 2 cut(s) 93, 231
Bst4CI ACNGT 1 cut(s) 70
BstBAI YACGTR 1 cut(s) 11
BstDEI CTNAG 2 cut(s) 152, 211
BstENI CCTNNNNNAGG 1 cut(s) 29
BstHHI GCGC 1 cut(s) 119
BstKTI GATC 2 cut(s) 58, 166
BstMBI GATC 2 cut(s) 55, 163
BstNI CCWGG 2 cut(s) 93, 231
BstSCI CCNGG 2 cut(s) 91, 229
BsuRI GGCC 1 cut(s) 90
BtsI GCAGTG 1 cut(s) 103
BtsIMutI CAGTG 1 cut(s) 103
CfoI GCGC 1 cut(s) 119
Cfr13I GGNCC 1 cut(s) 89
CsiI ACCWGGT 1 cut(s) 229
Csp6I GTAC 2 cut(s) 108, 227
CviJI RGCY 5 cut(s) 38, 48, 90, 210, 215
CviKI_1 RGCY 5 cut(s) 38, 48, 90, 210, 215
CviQI GTAC 2 cut(s) 108, 227
DdeI CTNAG 2 cut(s) 152, 211
DpnI GATC 2 cut(s) 57, 165
DpnII GATC 2 cut(s) 55, 163
Eco72I CACGTG 1 cut(s) 11
EcoNI CCTNNNNNAGG 1 cut(s) 29
EcoRII CCWGG 2 cut(s) 91, 229
FaiI YATR 3 cut(s) 207, 220, 225
FspI TGCGCA 1 cut(s) 118
GlaI GCGC 1 cut(s) 118
HaeIII GGCC 1 cut(s) 90
HhaI GCGC 1 cut(s) 119
Hin6I GCGC 1 cut(s) 117
HinP1I GCGC 1 cut(s) 117
HindIII AAGCTT 1 cut(s) 46
HinfI GANTC 1 cut(s) 61
HphI GGTGA 1 cut(s) 173
Hpy166II GTNNAC 2 cut(s) 6, 144
Hpy188I TCNGA 3 cut(s) 60, 153, 196
Hpy8I GTNNAC 2 cut(s) 6, 144
HpyCH4III ACNGT 1 cut(s) 70
HpyCH4IV ACGT 1 cut(s) 10
HpyCH4V TGCA 1 cut(s) 31
HpyF3I CTNAG 2 cut(s) 152, 211
HpySE526I ACGT 1 cut(s) 10
HspAI GCGC 1 cut(s) 117
KpnI GGTACC 1 cut(s) 111
Kzo9I GATC 2 cut(s) 55, 163
LpnPI CCDG 6 cut(s) 17, 78, 105, 144, 174, 216
MabI ACCWGGT 1 cut(s) 229
MaeII ACGT 1 cut(s) 10
MalI GATC 2 cut(s) 57, 165
MboI GATC 2 cut(s) 55, 163
MnlI CCTC 1 cut(s) 35
MseI TTAA 1 cut(s) 20
MslI CAYNNNNRTG 1 cut(s) 153
MspR9I CCNGG 2 cut(s) 93, 231
MvaI CCWGG 2 cut(s) 93, 231
NdeII GATC 2 cut(s) 55, 163
NlaIV GGNNCC 1 cut(s) 109
NsbI TGCGCA 1 cut(s) 118
PfeI GAWTC 1 cut(s) 61
PflMI CCANNNNNTGG 1 cut(s) 98
PmaCI CACGTG 1 cut(s) 11
PmlI CACGTG 1 cut(s) 11
Ppu21I YACGTR 1 cut(s) 11
Psp6I CCWGG 2 cut(s) 91, 229
PspCI CACGTG 1 cut(s) 11
PspGI CCWGG 2 cut(s) 91, 229
PspN4I GGNNCC 1 cut(s) 109
PspPI GGNCC 1 cut(s) 89
RsaI GTAC 2 cut(s) 109, 228
RsaNI GTAC 2 cut(s) 108, 227
RseI CAYNNNNRTG 1 cut(s) 153
SaqAI TTAA 1 cut(s) 20
Sau3AI GATC 2 cut(s) 55, 163
Sau96I GGNCC 1 cut(s) 89
ScrFI CCNGG 2 cut(s) 93, 231
SetI ASST 4 cut(s) 13, 50, 217, 235
SexAI ACCWGGT 1 cut(s) 229
SmiMI CAYNNNNRTG 1 cut(s) 153
StyD4I CCNGG 2 cut(s) 91, 229
TaaI ACNGT 1 cut(s) 70
TaiI ACGT 1 cut(s) 13
TaqI TCGA 1 cut(s) 43
TfiI GAWTC 1 cut(s) 61
Tru1I TTAA 1 cut(s) 20
Tru9I TTAA 1 cut(s) 20
TscAI CASTG 1 cut(s) 103
TspDTI ATGAA 1 cut(s) 226
TspRI CASTG 1 cut(s) 103
Van91I CCANNNNNTGG 1 cut(s) 98
XagI CCTNNNNNAGG 1 cut(s) 29
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.