Rmu_sc0004048.1_g000001

TMV resistance protein N-like

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0004048.1
Physical Location & Seq
Forward (+)
2731 .. 3205
475 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0004048.1_g000001.1.cds

Sequence Viewer

Length: 375 bp
atgcatgacctgatccaagacttgggattgcatattgttcgtaaagagtgtcctatggagccaggtcgacgcagtcggttgtggcatcaaaaagatatcatggaagtatcagcatacaataagggaacagaagcaattgaaggcatactcttaaacttgcctgatgatcatcaatcaacaatgatagaagatcgcttgaatcctaaagccttctccaagatgagcaatctgaggtttctcaaaattcacaatttgaggatgagccttcctctaatctccaaatatcttcctgattccttgaggcatttcaaatggagttcttcttttccaagcatagatgatcaagatggtgctagtgaggattgggatgagtag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

124

Amino Acids

14.47

Weight (kDa)

5.84

Isoelectric Point (pI)

83.43

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0031291)

Species Orthologous Gene IDs
rosa_multiflora Rmu_sc0004048.1_g000001
rosa_roxburghii Rroxscaffold_7G00192470

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 22
AccI GTMKAC 1 cut(s) 67
AclWI GGATC 1 cut(s) 7
AcsI RAATTY 1 cut(s) 243
AfiI CCNNNNNNNGG 1 cut(s) 22
AgsI TTSAA 3 cut(s) 140, 199, 310
AjnI CCWGG 1 cut(s) 61
AlwI GGATC 1 cut(s) 7
ApoI RAATTY 1 cut(s) 243
BccI CCATC 1 cut(s) 341
BcgI CGANNNNNNTGC 2 cut(s) 20, 54
BciT130I CCWGG 1 cut(s) 63
BclI TGATCA 2 cut(s) 166, 340
BfaI CTAG 1 cut(s) 354
Bme1390I CCNGG 1 cut(s) 63
BmiI GGNNCC 1 cut(s) 60
BmrFI CCNGG 1 cut(s) 63
BmsI GCATC 1 cut(s) 94
BplI GAGNNNNNCTC 2 cut(s) 253, 285
BpuEI CTTGAG 1 cut(s) 319
BsaBI GATNNNNATC 1 cut(s) 168
Bsc4I CCNNNNNNNGG 1 cut(s) 22
Bse8I GATNNNNATC 1 cut(s) 168
BseBI CCWGG 1 cut(s) 63
BseGI GGATG 2 cut(s) 264, 373
BseJI GATNNNNATC 1 cut(s) 168
BseLI CCNNNNNNNGG 1 cut(s) 22
BseMII CTCAG 1 cut(s) 221
BslI CCNNNNNNNGG 1 cut(s) 22
Bsp143I GATC 4 cut(s) 12, 166, 190, 340
BspCNI CTCAG 1 cut(s) 222
BspLI GGNNCC 1 cut(s) 60
BspPI GGATC 1 cut(s) 7
BssMI GATC 4 cut(s) 12, 166, 190, 340
Bst2UI CCWGG 1 cut(s) 63
BstDEI CTNAG 1 cut(s) 230
BstF5I GGATG 2 cut(s) 264, 373
BstKTI GATC 4 cut(s) 15, 169, 193, 343
BstMBI GATC 4 cut(s) 12, 166, 190, 340
BstNI CCWGG 1 cut(s) 63
BstSCI CCNGG 1 cut(s) 61
BtsCI GGATG 2 cut(s) 264, 373
CseI GACGC 1 cut(s) 78
CviAII CATG 2 cut(s) 5, 100
CviJI RGCY 3 cut(s) 61, 209, 264
CviKI_1 RGCY 3 cut(s) 61, 209, 264
DdeI CTNAG 1 cut(s) 230
DpnI GATC 4 cut(s) 14, 168, 192, 342
DpnII GATC 4 cut(s) 12, 166, 190, 340
Eco32I GATATC 1 cut(s) 97
EcoRII CCWGG 1 cut(s) 61
EcoRV GATATC 1 cut(s) 97
EcoT22I ATGCAT 1 cut(s) 6
FaeI CATG 2 cut(s) 8, 103
FaiI YATR 7 cut(s) 6, 33, 56, 101, 115, 146, 335
FatI CATG 2 cut(s) 4, 99
FbaI TGATCA 2 cut(s) 166, 340
FblI GTMKAC 1 cut(s) 67
FokI GGATG 1 cut(s) 271
FspBI CTAG 1 cut(s) 354
HgaI GACGC 1 cut(s) 78
Hin1II CATG 2 cut(s) 8, 103
HincII GTYRAC 1 cut(s) 68
HindII GTYRAC 1 cut(s) 68
HinfI GANTC 2 cut(s) 199, 293
Hpy166II GTNNAC 1 cut(s) 68
Hpy188I TCNGA 1 cut(s) 231
Hpy188III TCNNGA 2 cut(s) 290, 344
Hpy8I GTNNAC 1 cut(s) 68
Hpy99I CGWCG 1 cut(s) 72
HpyAV CCTTC 3 cut(s) 134, 220, 275
HpyCH4V TGCA 2 cut(s) 4, 31
HpyF3I CTNAG 1 cut(s) 230
Hsp92II CATG 2 cut(s) 8, 103
Ksp22I TGATCA 2 cut(s) 166, 340
Kzo9I GATC 4 cut(s) 12, 166, 190, 340
LmnI GCTCC 1 cut(s) 58
LpnPI CCDG 5 cut(s) 23, 48, 75, 174, 303
LweI GCATC 1 cut(s) 94
MaeI CTAG 1 cut(s) 354
MalI GATC 4 cut(s) 14, 168, 192, 342
MboI GATC 4 cut(s) 12, 166, 190, 340
MboII GAAGA 3 cut(s) 200, 278, 312
MfeI CAATTG 1 cut(s) 135
MluCI AATT 3 cut(s) 135, 243, 250
MnlI CCTC 5 cut(s) 225, 249, 279, 294, 352
Mph1103I ATGCAT 1 cut(s) 6
MseI TTAA 1 cut(s) 152
MspR9I CCNGG 1 cut(s) 63
MunI CAATTG 1 cut(s) 135
MvaI CCWGG 1 cut(s) 63
NdeII GATC 4 cut(s) 12, 166, 190, 340
NlaIII CATG 2 cut(s) 8, 103
NlaIV GGNNCC 1 cut(s) 60
NsiI ATGCAT 1 cut(s) 6
PfeI GAWTC 2 cut(s) 199, 293
PflFI GACNNNGTC 1 cut(s) 72
PflMI CCANNNNNTGG 1 cut(s) 22
Psp6I CCWGG 1 cut(s) 61
PspGI CCWGG 1 cut(s) 61
PspN4I GGNNCC 1 cut(s) 60
PsyI GACNNNGTC 1 cut(s) 72
SalI GTCGAC 1 cut(s) 66
SaqAI TTAA 1 cut(s) 152
Sau3AI GATC 4 cut(s) 12, 166, 190, 340
ScrFI CCNGG 1 cut(s) 63
SetI ASST 3 cut(s) 12, 67, 236
SfaNI GCATC 1 cut(s) 94
SmlI CTYRAG 1 cut(s) 298
SmoI CTYRAG 1 cut(s) 298
Sse9I AATT 3 cut(s) 135, 243, 250
SspMI CTAG 1 cut(s) 354
StyD4I CCNGG 1 cut(s) 61
TaqI TCGA 1 cut(s) 67
TasI AATT 3 cut(s) 135, 243, 250
TfiI GAWTC 2 cut(s) 199, 293
Tru1I TTAA 1 cut(s) 152
Tru9I TTAA 1 cut(s) 152
Tth111I GACNNNGTC 1 cut(s) 72
Van91I CCANNNNNTGG 1 cut(s) 22
XapI RAATTY 1 cut(s) 243
XmiI GTMKAC 1 cut(s) 67
XspI CTAG 1 cut(s) 354
Zsp2I ATGCAT 1 cut(s) 6
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.