Rmu_sc0004720.1_g000002

Ribonuclease H protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0004720.1
OG0031315
Physical Location & Seq
Reverse (-)
1935 .. 2252
318 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0004720.1_g000002.1.cds

Sequence Viewer

Length: 318 bp
atgaatttggatattttgagttggaattgttggggtataggtaatgcaacgacgatgagagctttgagggatctggtggttcaaaataggcctcagatcgtatttctgattgaaacaaaaatcagcgacttgaaggagtttcaagatctgcagcgagaactaggttttgcttattcaaaggaggctctcagcgcgttggatagtctggtggtttgggactattttggacggaggatgttgatcgatgtgcgtgtgcgcacgtcgtcggctcatcatattgatatggaaatcaagtctggcccggcagatcctcgttga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Exo_endo_phos

Protein Analysis

105

Amino Acids

12.09

Weight (kDa)

6.07

Isoelectric Point (pI)

37.61

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0031315)

Species Orthologous Gene IDs
rosa_multiflora Rmu_sc0004720.1_g000002
rosa_rugosa Rorug05G0370200

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc16I TGCGCA 1 cut(s) 257
AccII CGCG 1 cut(s) 194
AclWI GGATC 2 cut(s) 78, 302
AcsI RAATTY 1 cut(s) 4
AgsI TTSAA 5 cut(s) 83, 113, 133, 143, 177
AjiI CACGTC 1 cut(s) 261
AluBI AGCT 1 cut(s) 62
AluI AGCT 1 cut(s) 62
AlwI GGATC 2 cut(s) 78, 302
AoxI GGCC 2 cut(s) 89, 298
ApeKI GCWGC 1 cut(s) 151
ApoI RAATTY 1 cut(s) 4
AspLEI GCGC 2 cut(s) 194, 258
AspS9I GGNCC 1 cut(s) 299
AsuC2I CCSGG 1 cut(s) 302
BbvI GCAGC 1 cut(s) 163
BcnI CCSGG 1 cut(s) 302
BfaI CTAG 1 cut(s) 161
BfmI CTRYAG 1 cut(s) 149
BglII AGATCT 1 cut(s) 145
BisI GCNGC 1 cut(s) 152
BlsI GCNGC 1 cut(s) 153
Bme1390I CCNGG 1 cut(s) 302
BmgBI CACGTC 1 cut(s) 261
BmgT120I GGNCC 1 cut(s) 299
BmrFI CCNGG 1 cut(s) 302
BpuMI CCSGG 1 cut(s) 302
Bsa29I ATCGAT 1 cut(s) 243
BsaBI GATNNNNATC 1 cut(s) 239
Bse8I GATNNNNATC 1 cut(s) 239
BseCI ATCGAT 1 cut(s) 243
BseGI GGATG 1 cut(s) 240
BseJI GATNNNNATC 1 cut(s) 239
BseMII CTCAG 2 cut(s) 107, 202
BseXI GCAGC 1 cut(s) 163
Bsh1236I CGCG 1 cut(s) 194
BshFI GGCC 2 cut(s) 91, 300
BshVI ATCGAT 1 cut(s) 243
BsiSI CCGG 1 cut(s) 302
BslFI GGGAC 1 cut(s) 230
BsmFI GGGAC 1 cut(s) 230
BsnI GGCC 2 cut(s) 91, 300
Bsp143I GATC 5 cut(s) 70, 96, 145, 240, 307
BspANI GGCC 2 cut(s) 91, 300
BspCNI CTCAG 2 cut(s) 106, 201
BspDI ATCGAT 1 cut(s) 243
BspFNI CGCG 1 cut(s) 194
BspMAI CTGCAG 1 cut(s) 153
BspPI GGATC 2 cut(s) 78, 302
BssMI GATC 5 cut(s) 70, 96, 145, 240, 307
BstDEI CTNAG 2 cut(s) 93, 188
BstF5I GGATG 1 cut(s) 240
BstFNI CGCG 1 cut(s) 194
BstHHI GCGC 2 cut(s) 194, 258
BstKTI GATC 5 cut(s) 73, 99, 148, 243, 310
BstMBI GATC 5 cut(s) 70, 96, 145, 240, 307
BstMWI GCNNNNNNNGC 1 cut(s) 191
BstSCI CCNGG 1 cut(s) 300
BstSFI CTRYAG 1 cut(s) 149
BstUI CGCG 1 cut(s) 194
BstV1I GCAGC 1 cut(s) 163
BstX2I RGATCY 3 cut(s) 70, 145, 307
BstYI RGATCY 3 cut(s) 70, 145, 307
Bsu15I ATCGAT 1 cut(s) 243
BsuRI GGCC 2 cut(s) 91, 300
BsuTUI ATCGAT 1 cut(s) 243
BtrI CACGTC 1 cut(s) 261
BtsCI GGATG 1 cut(s) 240
CfoI GCGC 2 cut(s) 194, 258
Cfr13I GGNCC 1 cut(s) 299
ClaI ATCGAT 1 cut(s) 243
CviJI RGCY 5 cut(s) 62, 91, 185, 269, 300
CviKI_1 RGCY 5 cut(s) 62, 91, 185, 269, 300
DdeI CTNAG 2 cut(s) 93, 188
DpnI GATC 5 cut(s) 72, 98, 147, 242, 309
DpnII GATC 5 cut(s) 70, 96, 145, 240, 307
Eco147I AGGCCT 1 cut(s) 91
FaiI YATR 3 cut(s) 38, 276, 284
FaqI GGGAC 1 cut(s) 230
Fnu4HI GCNGC 1 cut(s) 152
FokI GGATG 1 cut(s) 247
Fsp4HI GCNGC 1 cut(s) 152
FspAI RTGCGCAY 1 cut(s) 257
FspBI CTAG 1 cut(s) 161
FspI TGCGCA 1 cut(s) 257
GlaI GCGC 2 cut(s) 193, 257
GluI GCNGC 1 cut(s) 152
HaeIII GGCC 2 cut(s) 91, 300
HapII CCGG 1 cut(s) 302
HhaI GCGC 2 cut(s) 194, 258
Hin6I GCGC 2 cut(s) 192, 256
HinP1I GCGC 2 cut(s) 192, 256
HpaII CCGG 1 cut(s) 302
Hpy188I TCNGA 2 cut(s) 96, 108
Hpy188III TCNNGA 1 cut(s) 143
Hpy99I CGWCG 3 cut(s) 55, 265, 268
HpyAV CCTTC 1 cut(s) 127
HpyCH4IV ACGT 1 cut(s) 260
HpyCH4V TGCA 2 cut(s) 47, 151
HpyF10VI GCNNNNNNNGC 1 cut(s) 191
HpyF3I CTNAG 2 cut(s) 93, 188
HpySE526I ACGT 1 cut(s) 260
HspAI GCGC 2 cut(s) 192, 256
Kzo9I GATC 5 cut(s) 70, 96, 145, 240, 307
LpnPI CCDG 3 cut(s) 59, 191, 282
Lsp1109I GCAGC 1 cut(s) 163
MaeI CTAG 1 cut(s) 161
MaeII ACGT 1 cut(s) 260
MalI GATC 5 cut(s) 72, 98, 147, 242, 309
MboI GATC 5 cut(s) 70, 96, 145, 240, 307
MflI RGATCY 3 cut(s) 70, 145, 307
MluCI AATT 2 cut(s) 4, 25
MmeI TCCRAC 1 cut(s) 177
MnlI CCTC 4 cut(s) 60, 102, 175, 225
MspI CCGG 1 cut(s) 302
MspR9I CCNGG 1 cut(s) 302
MvnI CGCG 1 cut(s) 194
MwoI GCNNNNNNNGC 1 cut(s) 191
NciI CCSGG 1 cut(s) 302
NdeII GATC 5 cut(s) 70, 96, 145, 240, 307
NsbI TGCGCA 1 cut(s) 257
PceI AGGCCT 1 cut(s) 91
PkrI GCNGC 1 cut(s) 153
PspPI GGNCC 1 cut(s) 299
PstI CTGCAG 1 cut(s) 153
PsuI RGATCY 3 cut(s) 70, 145, 307
SatI GCNGC 1 cut(s) 152
Sau3AI GATC 5 cut(s) 70, 96, 145, 240, 307
Sau96I GGNCC 1 cut(s) 299
ScrFI CCNGG 1 cut(s) 302
SetI ASST 4 cut(s) 43, 64, 166, 263
SfcI CTRYAG 1 cut(s) 149
Sse9I AATT 2 cut(s) 4, 25
SseBI AGGCCT 1 cut(s) 91
SspMI CTAG 1 cut(s) 161
StuI AGGCCT 1 cut(s) 91
StyD4I CCNGG 1 cut(s) 300
TaiI ACGT 1 cut(s) 263
TaqI TCGA 1 cut(s) 243
TasI AATT 2 cut(s) 4, 25
TseI GCWGC 1 cut(s) 151
TspDTI ATGAA 1 cut(s) 17
TspGWI ACGGA 1 cut(s) 244
XapI RAATTY 1 cut(s) 4
XspI CTAG 1 cut(s) 161
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.