Rmu_sc0004889.1_g000018

Tubulin is the major constituent of microtubules. It binds two moles of GTP, one at an exchangeable site on the beta chain and one at a non-exchangeable site on the alpha chain

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0004889.1
OG0031325
Physical Location & Seq
Forward (+)
74471 .. 74755
285 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0004889.1_g000018.1.cds

Sequence Viewer

Length: 285 bp
atgacctttatgggtcttctttgctatgagaagttgtctgggtcttccaatctctctcttatccctcatctctctaaagtttccatctctccatctttgccaccggacgcaacaccggcgactccgagctccaacttgagggtaatcgtctactacaacgaagccaggggcgaaaggtatgttgcacgcgccatcctcatggatctggagcttgggatcatggatgacgttagatcatggtcagatcgattctattgtcgatgtgatgatcatggtagattctaa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko04145 ko04540 ko05130 map04145 map04540 map05130
Pfam Domains
Protein Families
Tubulin Tubulin_C

Protein Analysis

94

Amino Acids

10.62

Weight (kDa)

6.04

Isoelectric Point (pI)

34.78

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0031325)

Species Orthologous Gene IDs
rosa_multiflora Rmu_sc0004889.1_g000018
rosa_roxburghii Rroxscaffold_4G00302430

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 150
AccII CGCG 1 cut(s) 189
AclWI GGATC 2 cut(s) 210, 224
AfiI CCNNNNNNNGG 1 cut(s) 138
AjnI CCWGG 1 cut(s) 164
AluBI AGCT 2 cut(s) 129, 211
AluI AGCT 2 cut(s) 129, 211
Alw21I GWGCWC 1 cut(s) 131
AlwI GGATC 2 cut(s) 210, 224
AspLEI GCGC 1 cut(s) 191
BanII GRGCYC 1 cut(s) 131
BbsI GAAGAC 2 cut(s) 8, 36
Bbv12I GWGCWC 1 cut(s) 131
BccI CCATC 3 cut(s) 92, 100, 200
BciT130I CCWGG 1 cut(s) 166
BclI TGATCA 1 cut(s) 268
Bme1390I CCNGG 1 cut(s) 166
BmrFI CCNGG 1 cut(s) 166
BpiI GAAGAC 2 cut(s) 8, 36
BpmI CTGGAG 1 cut(s) 227
BpuEI CTTGAG 1 cut(s) 157
Bsa29I ATCGAT 1 cut(s) 247
BsaJI CCNNGG 1 cut(s) 165
BsaWI WCCGGW 1 cut(s) 103
Bsc4I CCNNNNNNNGG 1 cut(s) 138
Bse118I RCCGGY 1 cut(s) 115
BseBI CCWGG 1 cut(s) 166
BseCI ATCGAT 1 cut(s) 247
BseDI CCNNGG 1 cut(s) 165
BseGI GGATG 2 cut(s) 192, 229
BseLI CCNNNNNNNGG 1 cut(s) 138
Bsh1236I CGCG 1 cut(s) 189
BshVI ATCGAT 1 cut(s) 247
BsiHKAI GWGCWC 1 cut(s) 131
BsiSI CCGG 2 cut(s) 104, 116
BslI CCNNNNNNNGG 1 cut(s) 138
Bsp1286I GDGCHC 1 cut(s) 131
Bsp143I GATC 5 cut(s) 202, 216, 233, 244, 268
BspDI ATCGAT 1 cut(s) 247
BspFNI CGCG 1 cut(s) 189
BspPI GGATC 2 cut(s) 210, 224
BsrFI RCCGGY 1 cut(s) 115
BssAI RCCGGY 1 cut(s) 115
BssECI CCNNGG 1 cut(s) 165
BssMI GATC 5 cut(s) 202, 216, 233, 244, 268
Bst2UI CCWGG 1 cut(s) 166
BstC8I GCNNGC 1 cut(s) 187
BstF5I GGATG 2 cut(s) 192, 229
BstFNI CGCG 1 cut(s) 189
BstHHI GCGC 1 cut(s) 191
BstKTI GATC 5 cut(s) 205, 219, 236, 247, 271
BstMBI GATC 5 cut(s) 202, 216, 233, 244, 268
BstMWI GCNNNNNNNGC 1 cut(s) 116
BstNI CCWGG 1 cut(s) 166
BstSCI CCNGG 1 cut(s) 164
BstUI CGCG 1 cut(s) 189
BstV2I GAAGAC 2 cut(s) 8, 36
BstX2I RGATCY 1 cut(s) 202
BstXI CCANNNNNNTGG 1 cut(s) 199
BstYI RGATCY 1 cut(s) 202
Bsu15I ATCGAT 1 cut(s) 247
BsuTUI ATCGAT 1 cut(s) 247
BtsCI GGATG 2 cut(s) 192, 229
Cac8I GCNNGC 1 cut(s) 187
CfoI GCGC 1 cut(s) 191
Cfr10I RCCGGY 1 cut(s) 115
ClaI ATCGAT 1 cut(s) 247
CseI GACGC 1 cut(s) 116
CviAII CATG 4 cut(s) 199, 220, 237, 272
CviJI RGCY 3 cut(s) 129, 164, 211
CviKI_1 RGCY 3 cut(s) 129, 164, 211
DpnI GATC 5 cut(s) 204, 218, 235, 246, 270
DpnII GATC 5 cut(s) 202, 216, 233, 244, 268
Ecl136II GAGCTC 1 cut(s) 129
Eco24I GRGCYC 1 cut(s) 131
Eco53kI GAGCTC 1 cut(s) 129
EcoICRI GAGCTC 1 cut(s) 129
EcoRII CCWGG 1 cut(s) 164
EcoT38I GRGCYC 1 cut(s) 131
FaeI CATG 4 cut(s) 202, 223, 240, 275
FaiI YATR 7 cut(s) 11, 27, 180, 200, 221, 238, 273
FatI CATG 4 cut(s) 198, 219, 236, 271
FbaI TGATCA 1 cut(s) 268
FblI GTMKAC 1 cut(s) 150
FokI GGATG 2 cut(s) 179, 236
FriOI GRGCYC 1 cut(s) 131
GlaI GCGC 1 cut(s) 190
GsuI CTGGAG 1 cut(s) 227
HapII CCGG 2 cut(s) 104, 116
HgaI GACGC 1 cut(s) 116
HhaI GCGC 1 cut(s) 191
Hin1II CATG 4 cut(s) 202, 223, 240, 275
Hin6I GCGC 1 cut(s) 189
HinP1I GCGC 1 cut(s) 189
HinfI GANTC 3 cut(s) 121, 249, 279
HpaII CCGG 2 cut(s) 104, 116
Hpy166II GTNNAC 1 cut(s) 151
Hpy188I TCNGA 2 cut(s) 126, 244
Hpy188III TCNNGA 1 cut(s) 206
Hpy8I GTNNAC 1 cut(s) 151
HpyCH4IV ACGT 1 cut(s) 228
HpyCH4V TGCA 1 cut(s) 185
HpyF10VI GCNNNNNNNGC 1 cut(s) 116
HpySE526I ACGT 1 cut(s) 228
Hsp92II CATG 4 cut(s) 202, 223, 240, 275
HspAI GCGC 1 cut(s) 189
Ksp22I TGATCA 1 cut(s) 268
Kzo9I GATC 5 cut(s) 202, 216, 233, 244, 268
LmnI GCTCC 2 cut(s) 134, 208
LpnPI CCDG 6 cut(s) 24, 117, 129, 151, 178, 191
MaeII ACGT 1 cut(s) 228
MalI GATC 5 cut(s) 204, 218, 235, 246, 270
MboI GATC 5 cut(s) 202, 216, 233, 244, 268
MboII GAAGA 2 cut(s) 8, 36
MflI RGATCY 1 cut(s) 202
MhlI GDGCHC 1 cut(s) 131
MlyI GAGTC 1 cut(s) 115
MmeI TCCRAC 1 cut(s) 156
MnlI CCTC 3 cut(s) 75, 132, 206
MslI CAYNNNNRTG 1 cut(s) 197
MspI CCGG 2 cut(s) 104, 116
MspR9I CCNGG 1 cut(s) 166
MvaI CCWGG 1 cut(s) 166
MvnI CGCG 1 cut(s) 189
MwoI GCNNNNNNNGC 1 cut(s) 116
NdeII GATC 5 cut(s) 202, 216, 233, 244, 268
NlaIII CATG 4 cut(s) 202, 223, 240, 275
PfeI GAWTC 2 cut(s) 249, 279
PleI GAGTC 1 cut(s) 115
PpsI GAGTC 1 cut(s) 115
Psp124BI GAGCTC 1 cut(s) 131
Psp6I CCWGG 1 cut(s) 164
PspGI CCWGG 1 cut(s) 164
PsuI RGATCY 1 cut(s) 202
RseI CAYNNNNRTG 1 cut(s) 197
SacI GAGCTC 1 cut(s) 131
Sau3AI GATC 5 cut(s) 202, 216, 233, 244, 268
SchI GAGTC 1 cut(s) 115
ScrFI CCNGG 1 cut(s) 166
SduI GDGCHC 1 cut(s) 131
SetI ASST 5 cut(s) 8, 131, 179, 213, 231
SgrAI CRCCGGYG 1 cut(s) 115
SmiMI CAYNNNNRTG 1 cut(s) 197
SmlI CTYRAG 1 cut(s) 136
SmoI CTYRAG 1 cut(s) 136
SstI GAGCTC 1 cut(s) 131
StyD4I CCNGG 1 cut(s) 164
TaiI ACGT 1 cut(s) 231
TaqI TCGA 2 cut(s) 247, 259
TfiI GAWTC 2 cut(s) 249, 279
XmiI GTMKAC 1 cut(s) 150
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.