Rmu_sc0005123.1_g000007

Belongs to the peptidase M16 family

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0005123.1
OG0031336
Physical Location & Seq
Forward (+)
16346 .. 21537
5192 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0005123.1_g000007.1.cds

Sequence Viewer

Length: 615 bp
atggctggggtgaaagaagagatattgaaagcccgtacggacaacagggagtacaggaggatcgtcctccctaactcccttgaagtcctcctcatcagcgatcctgatactaacaagtgtgctgcttccatggatgtcagtgttggttctttcagcgaccctgatggcgtggagggccttgcccatttccttgagcatatgctgttttatgctagtgagaagtaccctttggaggacagctacttgaagtacatcatcgagcatggaggaagaggaaatgctttcacttctgaagaacacaccagctatcgtttcgacattaatcccgatggttttgaagaggctctggacaggtttgctcagttctttattaaacccttgatgtcagctgatgctacagcgaggaaaattaaagctgttaattcagcaaatctgaaaactctgttgtccgatggctggagaatgaaccagcttcagaagcatctaagtgcagcgaatcatccttaccataaatttagatgggcaacaggtttgttggctggtgaatcagtttctactttggacttttctttctttgaaatagatattgatctcaccgatgcaggccagggttag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko05010 map05010
Pfam Domains
Protein Families
Peptidase_M16 Peptidase_M16_C Peptidase_M16_M

Protein Analysis

204

Amino Acids

22.92

Weight (kDa)

5.13

Isoelectric Point (pI)

27.95

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0031336)

Species Orthologous Gene IDs
rosa_multiflora Rmu_sc0005123.1_g000007
rosa_roxburghii Rroxscaffold_6G00399640

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 2 cut(s) 68, 95
AcsI RAATTY 1 cut(s) 512
AcuI CTGAAG 2 cut(s) 312, 458
AfaI GTAC 4 cut(s) 37, 53, 224, 251
AfiI CCNNNNNNNGG 2 cut(s) 232, 456
AgsI TTSAA 5 cut(s) 28, 83, 247, 338, 578
AjnI CCWGG 1 cut(s) 606
AjuI GAANNNNNNNTTGG 2 cut(s) 212, 244
AluBI AGCT 5 cut(s) 240, 306, 389, 416, 472
AluI AGCT 5 cut(s) 240, 306, 389, 416, 472
AlwI GGATC 2 cut(s) 68, 95
AoxI GGCC 2 cut(s) 175, 604
ApeKI GCWGC 2 cut(s) 122, 491
ApoI RAATTY 1 cut(s) 512
AseI ATTAAT 1 cut(s) 321
AspS9I GGNCC 1 cut(s) 175
AsuHPI GGTGA 3 cut(s) 22, 554, 586
BbvI GCAGC 2 cut(s) 109, 503
BccI CCATC 4 cut(s) 158, 323, 446, 513
BciT130I CCWGG 1 cut(s) 608
BfaI CTAG 1 cut(s) 213
BfmI CTRYAG 1 cut(s) 396
BisI GCNGC 2 cut(s) 123, 492
BlsI GCNGC 2 cut(s) 124, 493
Bme1390I CCNGG 1 cut(s) 608
BmgT120I GGNCC 1 cut(s) 175
BmrFI CCNGG 1 cut(s) 608
BmsI GCATC 3 cut(s) 382, 490, 589
BpmI CTGGAG 1 cut(s) 478
BpuEI CTTGAG 1 cut(s) 212
BsaBI GATNNNNATC 1 cut(s) 588
BsaJI CCNNGG 2 cut(s) 129, 607
Bsc4I CCNNNNNNNGG 2 cut(s) 232, 456
Bse8I GATNNNNATC 1 cut(s) 588
BseBI CCWGG 1 cut(s) 608
BseDI CCNNGG 2 cut(s) 129, 607
BseGI GGATG 2 cut(s) 139, 499
BseJI GATNNNNATC 1 cut(s) 588
BseLI CCNNNNNNNGG 2 cut(s) 232, 456
BseMII CTCAG 1 cut(s) 374
BseRI GAGGAG 1 cut(s) 80
BseXI GCAGC 2 cut(s) 109, 503
BseYI CCCAGC 1 cut(s) 5
BsgI GTGCAG 1 cut(s) 510
BshFI GGCC 2 cut(s) 177, 606
BsiWI CGTACG 1 cut(s) 35
BslI CCNNNNNNNGG 2 cut(s) 232, 456
BsnI GGCC 2 cut(s) 177, 606
Bsp143I GATC 3 cut(s) 60, 100, 589
Bsp19I CCATGG 1 cut(s) 129
BspANI GGCC 2 cut(s) 177, 606
BspCNI CTCAG 1 cut(s) 373
BspPI GGATC 2 cut(s) 68, 95
BssECI CCNNGG 2 cut(s) 129, 607
BssMI GATC 3 cut(s) 60, 100, 589
BssT1I CCWWGG 1 cut(s) 129
Bst2UI CCWGG 1 cut(s) 608
Bst6I CTCTTC 3 cut(s) 12, 265, 333
BstC8I GCNNGC 1 cut(s) 604
BstDEI CTNAG 2 cut(s) 360, 485
BstDSI CCRYGG 1 cut(s) 129
BstF5I GGATG 2 cut(s) 139, 499
BstKTI GATC 3 cut(s) 63, 103, 592
BstMBI GATC 3 cut(s) 60, 100, 589
BstMWI GCNNNNNNNGC 2 cut(s) 174, 478
BstNI CCWGG 1 cut(s) 608
BstSCI CCNGG 1 cut(s) 606
BstSFI CTRYAG 1 cut(s) 396
BstV1I GCAGC 2 cut(s) 109, 503
BsuRI GGCC 2 cut(s) 177, 606
BtgI CCRYGG 1 cut(s) 129
BtsCI GGATG 2 cut(s) 139, 499
BtsIMutI CAGTG 1 cut(s) 145
Cac8I GCNNGC 1 cut(s) 604
Cfr13I GGNCC 1 cut(s) 175
Csp6I GTAC 4 cut(s) 36, 52, 223, 250
CviAII CATG 2 cut(s) 130, 263
CviQI GTAC 4 cut(s) 36, 52, 223, 250
DdeI CTNAG 2 cut(s) 360, 485
DpnI GATC 3 cut(s) 62, 102, 591
DpnII GATC 3 cut(s) 60, 100, 589
Eam1104I CTCTTC 3 cut(s) 12, 265, 333
EarI CTCTTC 3 cut(s) 12, 265, 333
Eco130I CCWWGG 1 cut(s) 129
Eco57I CTGAAG 2 cut(s) 312, 458
EcoO109I RGGNCCY 1 cut(s) 175
EcoRII CCWGG 1 cut(s) 606
EcoT14I CCWWGG 1 cut(s) 129
ErhI CCWWGG 1 cut(s) 129
FaeI CATG 2 cut(s) 133, 266
FaiI YATR 6 cut(s) 131, 198, 200, 210, 264, 510
FatI CATG 2 cut(s) 129, 262
FauNDI CATATG 1 cut(s) 198
Fnu4HI GCNGC 2 cut(s) 123, 492
FokI GGATG 2 cut(s) 146, 486
Fsp4HI GCNGC 2 cut(s) 123, 492
FspBI CTAG 1 cut(s) 213
GluI GCNGC 2 cut(s) 123, 492
GsaI CCCAGC 1 cut(s) 9
GsuI CTGGAG 1 cut(s) 478
HaeIII GGCC 2 cut(s) 177, 606
Hin1II CATG 2 cut(s) 133, 266
HinfI GANTC 2 cut(s) 496, 545
HphI GGTGA 3 cut(s) 22, 554, 586
Hpy188I TCNGA 4 cut(s) 292, 435, 451, 477
Hpy188III TCNNGA 3 cut(s) 104, 326, 347
HpyCH4V TGCA 2 cut(s) 491, 602
HpyF10VI GCNNNNNNNGC 2 cut(s) 174, 478
HpyF3I CTNAG 2 cut(s) 360, 485
Hsp92II CATG 2 cut(s) 133, 266
Kzo9I GATC 3 cut(s) 60, 100, 589
Lsp1109I GCAGC 2 cut(s) 109, 503
LweI GCATC 3 cut(s) 382, 490, 589
MaeI CTAG 1 cut(s) 213
MalI GATC 3 cut(s) 62, 102, 591
MboI GATC 3 cut(s) 60, 100, 589
MboII GAAGA 4 cut(s) 29, 282, 305, 350
MluCI AATT 3 cut(s) 408, 421, 512
MseI TTAA 4 cut(s) 321, 372, 411, 420
MslI CAYNNNNRTG 1 cut(s) 486
MspA1I CMGCKG 1 cut(s) 389
MspR9I CCNGG 1 cut(s) 608
MvaI CCWGG 1 cut(s) 608
MwoI GCNNNNNNNGC 2 cut(s) 174, 478
NcoI CCATGG 1 cut(s) 129
NdeI CATATG 1 cut(s) 198
NdeII GATC 3 cut(s) 60, 100, 589
NlaIII CATG 2 cut(s) 133, 266
PfeI GAWTC 2 cut(s) 496, 545
Pfl23II CGTACG 1 cut(s) 35
PkrI GCNGC 2 cut(s) 124, 493
PshBI ATTAAT 1 cut(s) 321
Psp6I CCWGG 1 cut(s) 606
PspFI CCCAGC 1 cut(s) 5
PspGI CCWGG 1 cut(s) 606
PspLI CGTACG 1 cut(s) 35
PspPI GGNCC 1 cut(s) 175
PvuII CAGCTG 1 cut(s) 389
RsaI GTAC 4 cut(s) 37, 53, 224, 251
RsaNI GTAC 4 cut(s) 36, 52, 223, 250
RseI CAYNNNNRTG 1 cut(s) 486
SaqAI TTAA 4 cut(s) 321, 372, 411, 420
SatI GCNGC 2 cut(s) 123, 492
Sau3AI GATC 3 cut(s) 60, 100, 589
Sau96I GGNCC 1 cut(s) 175
ScrFI CCNGG 1 cut(s) 608
SetI ASST 7 cut(s) 242, 308, 356, 391, 418, 474, 532
SfaNI GCATC 3 cut(s) 382, 490, 589
SfcI CTRYAG 1 cut(s) 396
SmiMI CAYNNNNRTG 1 cut(s) 486
SmlI CTYRAG 1 cut(s) 191
SmoI CTYRAG 1 cut(s) 191
Sse9I AATT 3 cut(s) 408, 421, 512
SspMI CTAG 1 cut(s) 213
StyD4I CCNGG 1 cut(s) 606
StyI CCWWGG 1 cut(s) 129
TaqI TCGA 2 cut(s) 258, 315
TasI AATT 3 cut(s) 408, 421, 512
TatI WGTACW 2 cut(s) 51, 249
TfiI GAWTC 2 cut(s) 496, 545
Tru1I TTAA 4 cut(s) 321, 372, 411, 420
Tru9I TTAA 4 cut(s) 321, 372, 411, 420
TscAI CASTG 1 cut(s) 145
TseI GCWGC 2 cut(s) 122, 491
TspDTI ATGAA 1 cut(s) 479
TspGWI ACGGA 1 cut(s) 53
TspRI CASTG 1 cut(s) 145
VspI ATTAAT 1 cut(s) 321
XapI RAATTY 1 cut(s) 512
XspI CTAG 1 cut(s) 213
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.