Rmu_sc0006065.1_g000017

ankyrin repeat-containing protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0006065.1
OG0030978
Physical Location & Seq
Reverse (-)
93280 .. 93942
663 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0006065.1_g000017.1.cds

Sequence Viewer

Length: 663 bp
atgagtactgagagtagtcatccggggcgctcctttggggtgccatcattccaagaacaaatcagtcgtgatttcaagaaatttgagtcgcatccggatgacaaagactccggcacatcggcagttgctggcaaaccagaaaatgagaaatctgatgttaatctactgatagcgacacttatagcaacagttacattcgaggccggtctcgccccgccaggaggatatggagacgacggaaagataattttacaagacaatacaaatttcaaatggttttttacattgaacgttatctcgttcctactctcaagcctggttcttatccgagaatctgggccatgtttgggctccagactctccaaagtacttggtccattattgttcgctctccaatctgaaaccatcattacggcttccctttacggaatgcttttagcattttggcagggcacaacagcagggctaaacaaatcaaacacctcaatcaaatcgccctggcctggtcctctgacagtagcagctggaatagctttaatgatgtttggtttgggcccaggtttatttcaagcctgctcgaagaccagggatgcacttcgtgaaaaaagatcggactccggaggcgcgagattccgtggtatattctctttttggtcagagtaa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Ank Ank_2 Ank_3 Ank_4 Ank_5 PGG

Protein Analysis

220

Amino Acids

23.68

Weight (kDa)

7.76

Isoelectric Point (pI)

37.62

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0030978)

Species Orthologous Gene IDs
rosa_laevigata RLG00000032998
rosa_multiflora Rmu_sc0006065.1_g000017

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 40
AccII CGCG 1 cut(s) 626
AccIII TCCGGA 2 cut(s) 94, 617
AciI CCGC 1 cut(s) 215
AclI AACGTT 1 cut(s) 291
AcsI RAATTY 2 cut(s) 80, 265
AdeI CACNNNGTG 1 cut(s) 599
AfaI GTAC 2 cut(s) 7, 369
AfiI CCNNNNNNNGG 3 cut(s) 221, 347, 503
AgsI TTSAA 4 cut(s) 76, 271, 289, 569
AjnI CCWGG 6 cut(s) 217, 315, 497, 502, 556, 584
AluBI AGCT 2 cut(s) 524, 533
AluI AGCT 2 cut(s) 524, 533
Alw26I GTCTC 2 cut(s) 212, 225
AlwNI CAGNNNCTG 1 cut(s) 128
Aor13HI TCCGGA 2 cut(s) 94, 617
AoxI GGCC 4 cut(s) 201, 338, 500, 553
ApaI GGGCCC 1 cut(s) 557
ApeKI GCWGC 1 cut(s) 521
ApoI RAATTY 2 cut(s) 80, 265
AspLEI GCGC 2 cut(s) 30, 626
AspS9I GGNCC 5 cut(s) 338, 374, 506, 553, 554
AsuC2I CCSGG 1 cut(s) 24
AvaII GGWCC 2 cut(s) 374, 506
BaeGI GKGCMC 2 cut(s) 455, 557
BanI GGYRCC 1 cut(s) 40
BanII GRGCYC 2 cut(s) 353, 557
BbsI GAAGAC 1 cut(s) 587
BbvI GCAGC 1 cut(s) 533
BccI CCATC 2 cut(s) 52, 413
BceAI ACGGC 1 cut(s) 429
BciT130I CCWGG 6 cut(s) 219, 317, 499, 504, 558, 586
BcnI CCSGG 1 cut(s) 24
BcoDI GTCTC 2 cut(s) 212, 225
BfoI RGCGCY 1 cut(s) 31
BisI GCNGC 1 cut(s) 522
BlsI GCNGC 1 cut(s) 523
BmcAI AGTACT 2 cut(s) 7, 369
Bme1390I CCNGG 7 cut(s) 24, 219, 317, 499, 504, 558, 586
Bme18I GGWCC 2 cut(s) 374, 506
BmgT120I GGNCC 5 cut(s) 338, 374, 506, 553, 554
BmiI GGNNCC 3 cut(s) 42, 352, 555
BmrFI CCNGG 7 cut(s) 24, 219, 317, 499, 504, 558, 586
BmsI GCATC 2 cut(s) 100, 580
BpiI GAAGAC 1 cut(s) 587
BpmI CTGGAG 1 cut(s) 337
BpuEI CTTGAG 1 cut(s) 295
BpuMI CCSGG 1 cut(s) 24
BsaBI GATNNNNATC 1 cut(s) 159
BsaI GGTCTC 1 cut(s) 212
BsaJI CCNNGG 5 cut(s) 23, 497, 556, 585, 634
BsaWI WCCGGW 2 cut(s) 94, 617
BsaXI ACNNNNNCTCC 2 cut(s) 92, 122
Bsc4I CCNNNNNNNGG 3 cut(s) 221, 347, 503
Bse118I RCCGGY 1 cut(s) 203
Bse8I GATNNNNATC 1 cut(s) 159
BseAI TCCGGA 2 cut(s) 94, 617
BseBI CCWGG 6 cut(s) 219, 317, 499, 504, 558, 586
BseDI CCNNGG 5 cut(s) 23, 497, 556, 585, 634
BseGI GGATG 4 cut(s) 19, 91, 103, 595
BseJI GATNNNNATC 1 cut(s) 159
BseLI CCNNNNNNNGG 3 cut(s) 221, 347, 503
BseSI GKGCMC 2 cut(s) 455, 557
BseXI GCAGC 1 cut(s) 533
Bsh1236I CGCG 1 cut(s) 626
BshFI GGCC 4 cut(s) 203, 340, 502, 555
BshNI GGYRCC 1 cut(s) 40
BsiSI CCGG 5 cut(s) 23, 95, 111, 204, 618
BslI CCNNNNNNNGG 3 cut(s) 221, 347, 503
BsmAI GTCTC 2 cut(s) 212, 225
BsmBI CGTCTC 1 cut(s) 225
BsmI GAATGC 1 cut(s) 435
BsnI GGCC 4 cut(s) 203, 340, 502, 555
Bso31I GGTCTC 1 cut(s) 212
Bsp120I GGGCCC 1 cut(s) 553
Bsp1286I GDGCHC 3 cut(s) 353, 455, 557
Bsp13I TCCGGA 2 cut(s) 94, 617
Bsp143I GATC 1 cut(s) 608
BspACI CCGC 1 cut(s) 215
BspANI GGCC 4 cut(s) 203, 340, 502, 555
BspEI TCCGGA 2 cut(s) 94, 617
BspFNI CGCG 1 cut(s) 626
BspLI GGNNCC 3 cut(s) 42, 352, 555
BspT107I GGYRCC 1 cut(s) 40
BspTNI GGTCTC 1 cut(s) 212
BsrFI RCCGGY 1 cut(s) 203
BssAI RCCGGY 1 cut(s) 203
BssECI CCNNGG 5 cut(s) 23, 497, 556, 585, 634
BssMI GATC 1 cut(s) 608
Bst2UI CCWGG 6 cut(s) 219, 317, 499, 504, 558, 586
Bst4CI ACNGT 2 cut(s) 190, 517
BstC8I GCNNGC 2 cut(s) 130, 574
BstDEI CTNAG 1 cut(s) 9
BstDSI CCRYGG 1 cut(s) 634
BstF5I GGATG 4 cut(s) 19, 91, 103, 595
BstFNI CGCG 1 cut(s) 626
BstH2I RGCGCY 1 cut(s) 31
BstHHI GCGC 2 cut(s) 30, 626
BstKTI GATC 1 cut(s) 611
BstMAI GTCTC 2 cut(s) 212, 225
BstMBI GATC 1 cut(s) 608
BstMWI GCNNNNNNNGC 2 cut(s) 209, 530
BstNI CCWGG 6 cut(s) 219, 317, 499, 504, 558, 586
BstSCI CCNGG 7 cut(s) 22, 217, 315, 497, 502, 556, 584
BstSLI GKGCMC 2 cut(s) 455, 557
BstUI CGCG 1 cut(s) 626
BstV1I GCAGC 1 cut(s) 533
BstV2I GAAGAC 1 cut(s) 587
BsuRI GGCC 4 cut(s) 203, 340, 502, 555
BtgI CCRYGG 1 cut(s) 634
BtsCI GGATG 4 cut(s) 19, 91, 103, 595
Cac8I GCNNGC 2 cut(s) 130, 574
CaiI CAGNNNCTG 1 cut(s) 128
CfoI GCGC 2 cut(s) 30, 626
Cfr10I RCCGGY 1 cut(s) 203
Cfr13I GGNCC 5 cut(s) 338, 374, 506, 553, 554
Csp6I GTAC 2 cut(s) 6, 368
CviAII CATG 1 cut(s) 342
CviQI GTAC 2 cut(s) 6, 368
DdeI CTNAG 1 cut(s) 9
DpnI GATC 1 cut(s) 610
DpnII GATC 1 cut(s) 608
DraIII CACNNNGTG 1 cut(s) 599
Eco24I GRGCYC 2 cut(s) 353, 557
Eco31I GGTCTC 1 cut(s) 212
Eco47I GGWCC 2 cut(s) 374, 506
EcoRII CCWGG 6 cut(s) 217, 315, 497, 502, 556, 584
EcoT38I GRGCYC 2 cut(s) 353, 557
Esp3I CGTCTC 1 cut(s) 225
FaeI CATG 1 cut(s) 345
FaiI YATR 4 cut(s) 182, 228, 343, 641
FatI CATG 1 cut(s) 341
FauI CCCGC 1 cut(s) 222
Fnu4HI GCNGC 1 cut(s) 522
FokI GGATG 4 cut(s) 6, 78, 110, 602
FriOI GRGCYC 2 cut(s) 353, 557
Fsp4HI GCNGC 1 cut(s) 522
GlaI GCGC 2 cut(s) 29, 625
GluI GCNGC 1 cut(s) 522
GsuI CTGGAG 1 cut(s) 337
HaeII RGCGCY 1 cut(s) 31
HaeIII GGCC 4 cut(s) 203, 340, 502, 555
HapII CCGG 5 cut(s) 23, 95, 111, 204, 618
HhaI GCGC 2 cut(s) 30, 626
Hin1II CATG 1 cut(s) 345
Hin6I GCGC 2 cut(s) 28, 624
HinP1I GCGC 2 cut(s) 28, 624
HinfI GANTC 6 cut(s) 86, 107, 332, 357, 614, 630
HpaII CCGG 5 cut(s) 23, 95, 111, 204, 618
Hpy188I TCNGA 6 cut(s) 154, 329, 400, 513, 613, 658
Hpy188III TCNNGA 6 cut(s) 68, 76, 95, 354, 599, 618
Hpy99I CGWCG 1 cut(s) 239
HpyCH4III ACNGT 2 cut(s) 190, 517
HpyCH4IV ACGT 1 cut(s) 291
HpyCH4V TGCA 1 cut(s) 593
HpyF10VI GCNNNNNNNGC 2 cut(s) 209, 530
HpyF3I CTNAG 1 cut(s) 9
HpySE526I ACGT 1 cut(s) 291
Hsp92II CATG 1 cut(s) 345
HspAI GCGC 2 cut(s) 28, 624
Kpn2I TCCGGA 2 cut(s) 94, 617
Kzo9I GATC 1 cut(s) 608
LmnI GCTCC 2 cut(s) 35, 356
Lsp1109I GCAGC 1 cut(s) 533
LweI GCATC 2 cut(s) 100, 580
MaeII ACGT 1 cut(s) 291
MaeIII GTNAC 1 cut(s) 190
MalI GATC 1 cut(s) 610
MboI GATC 1 cut(s) 608
MboII GAAGA 1 cut(s) 592
MhlI GDGCHC 3 cut(s) 353, 455, 557
MluCI AATT 3 cut(s) 80, 246, 265
MlyI GAGTC 4 cut(s) 95, 101, 351, 608
MnlI CCTC 5 cut(s) 193, 215, 493, 519, 614
MroI TCCGGA 2 cut(s) 94, 617
MseI TTAA 2 cut(s) 159, 536
MslI CAYNNNNRTG 1 cut(s) 96
MspA1I CMGCKG 1 cut(s) 524
MspI CCGG 5 cut(s) 23, 95, 111, 204, 618
MspR9I CCNGG 7 cut(s) 24, 219, 317, 499, 504, 558, 586
Mva1269I GAATGC 1 cut(s) 435
MvaI CCWGG 6 cut(s) 219, 317, 499, 504, 558, 586
MvnI CGCG 1 cut(s) 626
MwoI GCNNNNNNNGC 2 cut(s) 209, 530
NciI CCSGG 1 cut(s) 24
NdeII GATC 1 cut(s) 608
NlaIII CATG 1 cut(s) 345
NlaIV GGNNCC 3 cut(s) 42, 352, 555
PctI GAATGC 1 cut(s) 435
PfeI GAWTC 2 cut(s) 332, 630
PkrI GCNGC 1 cut(s) 523
PleI GAGTC 4 cut(s) 94, 101, 351, 608
PpsI GAGTC 4 cut(s) 94, 101, 351, 608
Psp1406I AACGTT 1 cut(s) 291
Psp6I CCWGG 6 cut(s) 217, 315, 497, 502, 556, 584
PspGI CCWGG 6 cut(s) 217, 315, 497, 502, 556, 584
PspN4I GGNNCC 3 cut(s) 42, 352, 555
PspOMI GGGCCC 1 cut(s) 553
PspPI GGNCC 5 cut(s) 338, 374, 506, 553, 554
PstNI CAGNNNCTG 1 cut(s) 128
PvuII CAGCTG 1 cut(s) 524
RsaI GTAC 2 cut(s) 7, 369
RsaNI GTAC 2 cut(s) 6, 368
RseI CAYNNNNRTG 1 cut(s) 96
SaqAI TTAA 2 cut(s) 159, 536
SatI GCNGC 1 cut(s) 522
Sau3AI GATC 1 cut(s) 608
Sau96I GGNCC 5 cut(s) 338, 374, 506, 553, 554
ScaI AGTACT 2 cut(s) 7, 369
SchI GAGTC 4 cut(s) 95, 101, 351, 608
ScrFI CCNGG 7 cut(s) 24, 219, 317, 499, 504, 558, 586
SduI GDGCHC 3 cut(s) 353, 455, 557
SetI ASST 5 cut(s) 294, 485, 526, 535, 562
SfaNI GCATC 2 cut(s) 100, 580
SinI GGWCC 2 cut(s) 374, 506
SmiMI CAYNNNNRTG 1 cut(s) 96
SmlI CTYRAG 1 cut(s) 310
SmoI CTYRAG 1 cut(s) 310
Sse9I AATT 3 cut(s) 80, 246, 265
SsiI CCGC 1 cut(s) 215
StyD4I CCNGG 7 cut(s) 22, 217, 315, 497, 502, 556, 584
TaaI ACNGT 2 cut(s) 190, 517
TaiI ACGT 1 cut(s) 294
TaqI TCGA 2 cut(s) 198, 578
TasI AATT 3 cut(s) 80, 246, 265
TatI WGTACW 2 cut(s) 5, 367
TfiI GAWTC 2 cut(s) 332, 630
Tru1I TTAA 2 cut(s) 159, 536
Tru9I TTAA 2 cut(s) 159, 536
TseI GCWGC 1 cut(s) 521
TspGWI ACGGA 3 cut(s) 252, 441, 623
VpaK11BI GGWCC 2 cut(s) 374, 506
XapI RAATTY 2 cut(s) 80, 265
ZrmI AGTACT 2 cut(s) 7, 369
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.