Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0006192.1

Orthogroup ID

OG0031361

Physical Location & Seq

Genomic Coordinates Reverse (-)

14320 .. 15060

Gene Structure 741 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0006192.1_g000002.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 741 bp

atgtcttcaccgggtcataatagccccgagtctttccctccctccctcgccaaccagttcaatttcatgtcatgctggaattccctactcttcatttgtttgcttcagaccactcttctccaaatgagcagactcgttttcaaatcaaatccacaccctcctccctgtcttcttcttcttcaaacatgttcaagcatgaaccaactcaagcaaatccatgcccacacactcatcaccggcctagctcgtttcacctacatcaccagcaagctcttagccttctccgccttatcggaacacggtgatttacgccacgcagagactatattcaatcgaattccgtcacccaatgtctttgatttcaattccatgatcatgggtttcttgaaaaaatcacattccgaaaagggtctctctgtttttaccaaaatgagaaggataggcaccgacccaaatgctcgaactttcacagttttggttaaagcttgtgttggggtgcctttgcttgatcagatatatggtcagataatgaagtttggacatgagtgtgatgtttatgttactagctcagttattagtgtgtactgtaaattgagagctaagtgggcttccggatgtcttcaccgggtcataatagccccgagtctttccctccctccctcgccaaccagttcaatttcatgtcatgctggaattccctactcttcatttgtttgcttcagaccactcttctccaaatga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

PPR PPR_2

Protein Analysis

246

Amino Acids

27.35

Weight (kDa)

9.44

Isoelectric Point (pI)

55.59

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0031361)

Species	Orthologous Gene IDs
rosa_multiflora	Rmu_sc0006192.1_g000002
rosa_samantha	Rh4BG102600

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccB1I	GGYRCC	2 cut(s)	443, 496
AccIII	TCCGGA	1 cut(s)	611
AciI	CCGC	1 cut(s)	285
AcsI	RAATTY	3 cut(s)	79, 336, 693
AcuI	CTGAAG	2 cut(s)	89, 703
AfaI	GTAC	1 cut(s)	584
AflIII	ACRYGT	1 cut(s)	185
AgsI	TTSAA	8 cut(s)	61, 142, 182, 192, 331, 364, 388, 675
AluBI	AGCT	5 cut(s)	245, 271, 485, 567, 599
AluI	AGCT	5 cut(s)	245, 271, 485, 567, 599
Alw26I	GTCTC	2 cut(s)	314, 416
Ama87I	CYCGRG	2 cut(s)	26, 640
Aor13HI	TCCGGA	1 cut(s)	611
AoxI	GGCC	1 cut(s)	238
ApoI	RAATTY	3 cut(s)	79, 336, 693
AsuC2I	CCSGG	2 cut(s)	12, 626
AsuHPI	GGTGA	6 cut(s)	226, 244, 253, 314, 336, 614
AvaI	CYCGRG	2 cut(s)	26, 640
BanI	GGYRCC	2 cut(s)	443, 496
BbsI	GAAGAC	2 cut(s)	161, 611
BcgI	CGANNNNNNTGC	2 cut(s)	437, 471
BclI	TGATCA	2 cut(s)	372, 508
BcnI	CCSGG	2 cut(s)	12, 626
BcoDI	GTCTC	2 cut(s)	314, 416
BfaI	CTAG	2 cut(s)	242, 564
Bme1390I	CCNGG	2 cut(s)	12, 626
BmeT110I	CYCGRG	2 cut(s)	26, 640
BmiI	GGNNCC	2 cut(s)	445, 498
BmrFI	CCNGG	2 cut(s)	12, 626
BpiI	GAAGAC	2 cut(s)	161, 611
BpuEI	CTTGAG	1 cut(s)	191
BpuMI	CCSGG	2 cut(s)	12, 626
BsaI	GGTCTC	1 cut(s)	416
BsaWI	WCCGGW	1 cut(s)	611
Bse118I	RCCGGY	1 cut(s)	236
Bse1I	ACTGG	2 cut(s)	55, 669
BseAI	TCCGGA	1 cut(s)	611
BseGI	GGATG	1 cut(s)	620
BseMII	CTCAG	1 cut(s)	582
BseNI	ACTGG	2 cut(s)	55, 669
BseRI	GAGGAG	1 cut(s)	150
BshFI	GGCC	1 cut(s)	240
BshNI	GGYRCC	2 cut(s)	443, 496
BsiHKCI	CYCGRG	2 cut(s)	26, 640
BsiSI	CCGG	4 cut(s)	11, 237, 612, 625
BsmAI	GTCTC	2 cut(s)	314, 416
BsnI	GGCC	1 cut(s)	240
Bso31I	GGTCTC	1 cut(s)	416
BsoBI	CYCGRG	2 cut(s)	26, 640
Bsp13I	TCCGGA	1 cut(s)	611
Bsp143I	GATC	2 cut(s)	372, 508
BspACI	CCGC	1 cut(s)	285
BspANI	GGCC	1 cut(s)	240
BspCNI	CTCAG	1 cut(s)	581
BspEI	TCCGGA	1 cut(s)	611
BspLI	GGNNCC	2 cut(s)	445, 498
BspT107I	GGYRCC	2 cut(s)	443, 496
BspTNI	GGTCTC	1 cut(s)	416
BsrFI	RCCGGY	1 cut(s)	236
BsrI	ACTGG	2 cut(s)	55, 669
BssAI	RCCGGY	1 cut(s)	236
BssMI	GATC	2 cut(s)	372, 508
Bst4CI	ACNGT	3 cut(s)	302, 472, 587
Bst6I	CTCTTC	4 cut(s)	95, 120, 709, 734
BstC8I	GCNNGC	1 cut(s)	269
BstDEI	CTNAG	3 cut(s)	274, 568, 600
BstF5I	GGATG	1 cut(s)	620
BstKTI	GATC	2 cut(s)	375, 511
BstMAI	GTCTC	2 cut(s)	314, 416
BstMBI	GATC	2 cut(s)	372, 508
BstMWI	GCNNNNNNNGC	2 cut(s)	284, 605
BstNSI	RCATGY	1 cut(s)	189
BstSCI	CCNGG	2 cut(s)	10, 624
BstV2I	GAAGAC	2 cut(s)	161, 611
BstXI	CCANNNNNNTGG	1 cut(s)	376
BsuRI	GGCC	1 cut(s)	240
BtsCI	GGATG	1 cut(s)	620
Cac8I	GCNNGC	1 cut(s)	269
Cfr10I	RCCGGY	1 cut(s)	236
Csp6I	GTAC	1 cut(s)	583
CviQI	GTAC	1 cut(s)	583
DdeI	CTNAG	3 cut(s)	274, 568, 600
DpnI	GATC	2 cut(s)	374, 510
DpnII	GATC	2 cut(s)	372, 508
Eam1104I	CTCTTC	4 cut(s)	95, 120, 709, 734
EarI	CTCTTC	4 cut(s)	95, 120, 709, 734
EciI	GGCGGA	1 cut(s)	274
Eco31I	GGTCTC	1 cut(s)	416
Eco57I	CTGAAG	2 cut(s)	89, 703
Eco88I	CYCGRG	2 cut(s)	26, 640
EcoRI	GAATTC	3 cut(s)	79, 336, 693
FbaI	TGATCA	2 cut(s)	372, 508
FokI	GGATG	1 cut(s)	627
FspBI	CTAG	2 cut(s)	242, 564
HaeIII	GGCC	1 cut(s)	240
HapII	CCGG	4 cut(s)	11, 237, 612, 625
HindIII	AAGCTT	1 cut(s)	483
HinfI	GANTC	3 cut(s)	29, 132, 643
HpaII	CCGG	4 cut(s)	11, 237, 612, 625
HphI	GGTGA	6 cut(s)	226, 244, 253, 314, 336, 614
Hpy166II	GTNNAC	1 cut(s)	583
Hpy188I	TCNGA	6 cut(s)	108, 295, 403, 513, 525, 722
Hpy188III	TCNNGA	2 cut(s)	385, 612
Hpy8I	GTNNAC	1 cut(s)	583
HpyAV	CCTTC	2 cut(s)	289, 429
HpyCH4III	ACNGT	3 cut(s)	302, 472, 587
HpyF10VI	GCNNNNNNNGC	2 cut(s)	284, 605
HpyF3I	CTNAG	3 cut(s)	274, 568, 600
Kpn2I	TCCGGA	1 cut(s)	611
Ksp22I	TGATCA	2 cut(s)	372, 508
Kzo9I	GATC	2 cut(s)	372, 508
MaeI	CTAG	2 cut(s)	242, 564
MaeIII	GTNAC	2 cut(s)	342, 559
MalI	GATC	2 cut(s)	374, 510
MboI	GATC	2 cut(s)	372, 508
MboII	GAAGA	9 cut(s)	82, 107, 161, 164, 167, 170, 611, 696, 721
MluCI	AATT	7 cut(s)	61, 79, 336, 364, 590, 675, 693
MlyI	GAGTC	3 cut(s)	38, 126, 652
MnlI	CCTC	8 cut(s)	48, 52, 56, 168, 171, 662, 666, 670
MroI	TCCGGA	1 cut(s)	611
MseI	TTAA	1 cut(s)	480
MslI	CAYNNNNRTG	2 cut(s)	374, 546
MspI	CCGG	4 cut(s)	11, 237, 612, 625
MspR9I	CCNGG	2 cut(s)	12, 626
MwoI	GCNNNNNNNGC	2 cut(s)	284, 605
NciI	CCSGG	2 cut(s)	12, 626
NdeII	GATC	2 cut(s)	372, 508
NlaIV	GGNNCC	2 cut(s)	445, 498
NmuCI	GTSAC	1 cut(s)	342
NspI	RCATGY	1 cut(s)	189
PciI	ACATGT	1 cut(s)	185
PleI	GAGTC	3 cut(s)	37, 126, 651
PpsI	GAGTC	3 cut(s)	37, 126, 651
PscI	ACATGT	1 cut(s)	185
PspN4I	GGNNCC	2 cut(s)	445, 498
RsaI	GTAC	1 cut(s)	584
RsaNI	GTAC	1 cut(s)	583
RseI	CAYNNNNRTG	2 cut(s)	374, 546
SaqAI	TTAA	1 cut(s)	480
Sau3AI	GATC	2 cut(s)	372, 508
SchI	GAGTC	3 cut(s)	38, 126, 652
ScrFI	CCNGG	2 cut(s)	12, 626
SetI	ASST	6 cut(s)	247, 257, 273, 487, 569, 601
SmiMI	CAYNNNNRTG	2 cut(s)	374, 546
SmlI	CTYRAG	1 cut(s)	206
SmoI	CTYRAG	1 cut(s)	206
Sse9I	AATT	7 cut(s)	61, 79, 336, 364, 590, 675, 693
SsiI	CCGC	1 cut(s)	285
SspMI	CTAG	2 cut(s)	242, 564
StyD4I	CCNGG	2 cut(s)	10, 624
TaaI	ACNGT	3 cut(s)	302, 472, 587
TaqI	TCGA	2 cut(s)	334, 460
TasI	AATT	7 cut(s)	61, 79, 336, 364, 590, 675, 693
TatI	WGTACW	1 cut(s)	582
Tru1I	TTAA	1 cut(s)	480
Tru9I	TTAA	1 cut(s)	480
TseFI	GTSAC	1 cut(s)	342
Tsp45I	GTSAC	1 cut(s)	342
TspDTI	ATGAA	6 cut(s)	55, 82, 212, 545, 669, 696
TspGWI	ACGGA	1 cut(s)	330
XapI	RAATTY	3 cut(s)	79, 336, 693
XceI	RCATGY	1 cut(s)	189
XspI	CTAG	2 cut(s)	242, 564

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.