Rmu_sc0006266.1_g000002

11S globulin seed storage protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0006266.1
OG0031367
Physical Location & Seq
Forward (+)
698 .. 991
294 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0006266.1_g000002.1.cds

Sequence Viewer

Length: 294 bp
atgaccatgcctaagcccaacgaactcttcaccaaaaaacttgttcatcaactcactgttagtgccactttgactgagaacgggtttcattttcttaaccaagttgggttaagtgccaacctcttaaaacttgaaccctatgcaatttcctctcccacttacactaccgattctacggttcaagtgatctatgttgttggaggaggcggtcgagtccaaatagcgggtcttaatggccagcgtgtgttggatgcggaagtaattaactgtgggtcacttgatcgtcgtgcctag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Cupin_1

Protein Analysis

97

Amino Acids

10.48

Weight (kDa)

7.91

Isoelectric Point (pI)

25.16

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0031367)

Species Orthologous Gene IDs
rosa_multiflora Rmu_co8190276.1_g000001 Rmu_sc0006266.1_g000002

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 3 cut(s) 207, 224, 254
AcoI YGGCCR 1 cut(s) 235
AfiI CCNNNNNNNGG 1 cut(s) 223
AgsI TTSAA 2 cut(s) 134, 182
AjuI GAANNNNNNNTTGG 2 cut(s) 11, 43
AoxI GGCC 1 cut(s) 235
ArsI GACNNNNNNTTYG 2 cut(s) 211, 243
AsuHPI GGTGA 1 cut(s) 22
BalI TGGCCA 1 cut(s) 237
BfaI CTAG 1 cut(s) 292
BmsI GCATC 1 cut(s) 241
Bpu10I CCTNAGC 1 cut(s) 12
Bsc4I CCNNNNNNNGG 1 cut(s) 223
BseGI GGATG 1 cut(s) 256
BseLI CCNNNNNNNGG 1 cut(s) 223
BseMII CTCAG 1 cut(s) 66
BseRI GAGGAG 1 cut(s) 216
Bsh1285I CGRYCG 1 cut(s) 211
BshFI GGCC 1 cut(s) 237
BsiEI CGRYCG 1 cut(s) 211
BslI CCNNNNNNNGG 1 cut(s) 223
BsnI GGCC 1 cut(s) 237
Bsp143I GATC 2 cut(s) 186, 280
BspACI CCGC 3 cut(s) 207, 224, 254
BspANI GGCC 1 cut(s) 237
BspCNI CTCAG 1 cut(s) 67
BssMI GATC 2 cut(s) 186, 280
Bst4CI ACNGT 3 cut(s) 58, 178, 269
Bst6I CTCTTC 1 cut(s) 32
BstC8I GCNNGC 1 cut(s) 239
BstDEI CTNAG 2 cut(s) 12, 75
BstF5I GGATG 1 cut(s) 256
BstKTI GATC 2 cut(s) 189, 283
BstMBI GATC 2 cut(s) 186, 280
BstMCI CGRYCG 1 cut(s) 211
BsuRI GGCC 1 cut(s) 237
BtsCI GGATG 1 cut(s) 256
BtsIMutI CAGTG 1 cut(s) 54
Cac8I GCNNGC 1 cut(s) 239
CviAII CATG 1 cut(s) 7
CviJI RGCY 2 cut(s) 16, 237
CviKI_1 RGCY 2 cut(s) 16, 237
DdeI CTNAG 2 cut(s) 12, 75
DpnI GATC 2 cut(s) 188, 282
DpnII GATC 2 cut(s) 186, 280
EaeI YGGCCR 1 cut(s) 235
Eam1104I CTCTTC 1 cut(s) 32
EarI CTCTTC 1 cut(s) 32
FaeI CATG 1 cut(s) 10
FaiI YATR 3 cut(s) 8, 141, 192
FatI CATG 1 cut(s) 6
FauI CCCGC 1 cut(s) 217
FokI GGATG 1 cut(s) 263
FspBI CTAG 1 cut(s) 292
HaeIII GGCC 1 cut(s) 237
Hin1II CATG 1 cut(s) 10
HinfI GANTC 2 cut(s) 170, 213
HphI GGTGA 1 cut(s) 22
Hpy99I CGWCG 1 cut(s) 288
HpyCH4III ACNGT 3 cut(s) 58, 178, 269
HpyCH4V TGCA 1 cut(s) 143
HpyF3I CTNAG 2 cut(s) 12, 75
Hsp92II CATG 1 cut(s) 10
Kzo9I GATC 2 cut(s) 186, 280
LpnPI CCDG 1 cut(s) 251
LweI GCATC 1 cut(s) 241
MaeI CTAG 1 cut(s) 292
MaeIII GTNAC 1 cut(s) 273
MalI GATC 2 cut(s) 188, 282
MboI GATC 2 cut(s) 186, 280
MboII GAAGA 1 cut(s) 19
MlsI TGGCCA 1 cut(s) 237
MluCI AATT 2 cut(s) 144, 261
MluNI TGGCCA 1 cut(s) 237
MlyI GAGTC 1 cut(s) 222
MmeI TCCRAC 2 cut(s) 178, 228
MnlI CCTC 4 cut(s) 131, 160, 194, 197
Mox20I TGGCCA 1 cut(s) 237
MscI TGGCCA 1 cut(s) 237
MseI TTAA 5 cut(s) 96, 110, 125, 231, 264
Msp20I TGGCCA 1 cut(s) 237
NdeII GATC 2 cut(s) 186, 280
NlaIII CATG 1 cut(s) 10
NmuCI GTSAC 1 cut(s) 273
PfeI GAWTC 1 cut(s) 170
PleI GAGTC 1 cut(s) 221
PpsI GAGTC 1 cut(s) 221
SaqAI TTAA 5 cut(s) 96, 110, 125, 231, 264
Sau3AI GATC 2 cut(s) 186, 280
SchI GAGTC 1 cut(s) 222
SetI ASST 1 cut(s) 123
SfaNI GCATC 1 cut(s) 241
Sse9I AATT 2 cut(s) 144, 261
SsiI CCGC 3 cut(s) 207, 224, 254
SspMI CTAG 1 cut(s) 292
TaaI ACNGT 3 cut(s) 58, 178, 269
TaqI TCGA 1 cut(s) 211
TasI AATT 2 cut(s) 144, 261
TfiI GAWTC 1 cut(s) 170
Tru1I TTAA 5 cut(s) 96, 110, 125, 231, 264
Tru9I TTAA 5 cut(s) 96, 110, 125, 231, 264
TscAI CASTG 1 cut(s) 61
TseFI GTSAC 1 cut(s) 273
Tsp45I GTSAC 1 cut(s) 273
TspDTI ATGAA 2 cut(s) 35, 77
TspRI CASTG 1 cut(s) 61
XspI CTAG 1 cut(s) 292
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.