Rmu_sc0006895.1_g000008

disease resistance

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0006895.1
Physical Location & Seq
Forward (+)
25507 .. 25782
276 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0006895.1_g000008.1.cds

Sequence Viewer

Length: 276 bp
atgaatctcagatcattaccttttctgaatgtgggtaaggaaactgggcctcggattgaggagctgggtgggttaaaccatttgaaagataccttatctatctataatctgaagcatgtaagagatggagaagaagcagtgaatgcaaagttagttgataagaaacatatacgcaagttaaatctcgactggaagcttagtagaccaagcaacaatgttgacaatgatgatgttgtacttgaaggcctgcaccgcattataatttggaaattttga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

91

Amino Acids

10.51

Weight (kDa)

9.05

Isoelectric Point (pI)

30.59

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0031021)

Species Orthologous Gene IDs
rosa_multiflora Rmu_sc0006895.1_g000008 Rmu_ssc0000386.1_g000036

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 260
AccI GTMKAC 1 cut(s) 202
AciI CCGC 1 cut(s) 253
AcsI RAATTY 1 cut(s) 269
AcuI CTGAAG 1 cut(s) 131
AfaI GTAC 1 cut(s) 237
AgsI TTSAA 2 cut(s) 85, 242
AluBI AGCT 2 cut(s) 64, 196
AluI AGCT 2 cut(s) 64, 196
AoxI GGCC 2 cut(s) 47, 244
ApoI RAATTY 1 cut(s) 269
AspS9I GGNCC 1 cut(s) 47
BccI CCATC 1 cut(s) 119
BmgT120I GGNCC 1 cut(s) 47
BmrI ACTGGG 1 cut(s) 54
BmuI ACTGGG 1 cut(s) 54
BsaJI CCNNGG 1 cut(s) 50
Bse1I ACTGG 2 cut(s) 49, 194
BseDI CCNNGG 1 cut(s) 50
BseMII CTCAG 1 cut(s) 22
BseNI ACTGG 2 cut(s) 49, 194
BseRI GAGGAG 1 cut(s) 74
BseYI CCCAGC 1 cut(s) 64
BsgI GTGCAG 1 cut(s) 233
BshFI GGCC 2 cut(s) 49, 246
BsmI GAATGC 1 cut(s) 148
BsnI GGCC 2 cut(s) 49, 246
Bsp143I GATC 1 cut(s) 11
BspACI CCGC 1 cut(s) 253
BspANI GGCC 2 cut(s) 49, 246
BspCNI CTCAG 1 cut(s) 21
BsrI ACTGG 2 cut(s) 49, 194
BssECI CCNNGG 1 cut(s) 50
BssMI GATC 1 cut(s) 11
BstAPI GCANNNNNTGC 1 cut(s) 143
BstC8I GCNNGC 1 cut(s) 248
BstDEI CTNAG 2 cut(s) 8, 197
BstKTI GATC 1 cut(s) 14
BstMBI GATC 1 cut(s) 11
BstMWI GCNNNNNNNGC 2 cut(s) 143, 252
BstNSI RCATGY 1 cut(s) 119
BsuRI GGCC 2 cut(s) 49, 246
BtsI GCAGTG 1 cut(s) 144
BtsIMutI CAGTG 1 cut(s) 144
Cac8I GCNNGC 1 cut(s) 248
Cfr13I GGNCC 1 cut(s) 47
Csp6I GTAC 1 cut(s) 236
CviAII CATG 1 cut(s) 116
CviJI RGCY 4 cut(s) 49, 64, 196, 246
CviKI_1 RGCY 4 cut(s) 49, 64, 196, 246
CviQI GTAC 1 cut(s) 236
DdeI CTNAG 2 cut(s) 8, 197
DpnI GATC 1 cut(s) 13
DpnII GATC 1 cut(s) 11
Eco147I AGGCCT 1 cut(s) 246
Eco57I CTGAAG 1 cut(s) 131
FaeI CATG 1 cut(s) 119
FaiI YATR 5 cut(s) 105, 117, 168, 170, 260
FatI CATG 1 cut(s) 115
FblI GTMKAC 1 cut(s) 202
GsaI CCCAGC 1 cut(s) 68
HaeIII GGCC 2 cut(s) 49, 246
Hin1II CATG 1 cut(s) 119
HincII GTYRAC 1 cut(s) 220
HindII GTYRAC 1 cut(s) 220
HindIII AAGCTT 1 cut(s) 194
HinfI GANTC 1 cut(s) 4
Hpy166II GTNNAC 2 cut(s) 203, 220
Hpy188I TCNGA 4 cut(s) 11, 27, 54, 111
Hpy188III TCNNGA 1 cut(s) 185
Hpy8I GTNNAC 2 cut(s) 203, 220
HpyAV CCTTC 1 cut(s) 236
HpyCH4V TGCA 2 cut(s) 146, 250
HpyF10VI GCNNNNNNNGC 2 cut(s) 143, 252
HpyF3I CTNAG 2 cut(s) 8, 197
Hsp92II CATG 1 cut(s) 119
Kzo9I GATC 1 cut(s) 11
LmnI GCTCC 1 cut(s) 61
LpnPI CCDG 4 cut(s) 30, 50, 175, 260
MalI GATC 1 cut(s) 13
MboI GATC 1 cut(s) 11
MboII GAAGA 1 cut(s) 143
MluCI AATT 2 cut(s) 261, 269
MnlI CCTC 2 cut(s) 52, 60
MseI TTAA 2 cut(s) 74, 179
Mva1269I GAATGC 1 cut(s) 148
MwoI GCNNNNNNNGC 2 cut(s) 143, 252
NdeII GATC 1 cut(s) 11
NlaIII CATG 1 cut(s) 119
NspI RCATGY 1 cut(s) 119
PceI AGGCCT 1 cut(s) 246
PctI GAATGC 1 cut(s) 148
PfeI GAWTC 1 cut(s) 4
PsiI TTATAA 1 cut(s) 260
PspFI CCCAGC 1 cut(s) 64
PspPI GGNCC 1 cut(s) 47
RsaI GTAC 1 cut(s) 237
RsaNI GTAC 1 cut(s) 236
SaqAI TTAA 2 cut(s) 74, 179
Sau3AI GATC 1 cut(s) 11
Sau96I GGNCC 1 cut(s) 47
SetI ASST 4 cut(s) 22, 66, 95, 198
Sse9I AATT 2 cut(s) 261, 269
SseBI AGGCCT 1 cut(s) 246
SsiI CCGC 1 cut(s) 253
StuI AGGCCT 1 cut(s) 246
TaqI TCGA 1 cut(s) 186
TasI AATT 2 cut(s) 261, 269
TatI WGTACW 1 cut(s) 235
TfiI GAWTC 1 cut(s) 4
Tru1I TTAA 2 cut(s) 74, 179
Tru9I TTAA 2 cut(s) 74, 179
TscAI CASTG 1 cut(s) 144
TspDTI ATGAA 1 cut(s) 17
TspRI CASTG 1 cut(s) 144
XapI RAATTY 1 cut(s) 269
XceI RCATGY 1 cut(s) 119
XmiI GTMKAC 1 cut(s) 202
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.