Rmu_ssc0000386.1_g000036

disease resistance

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_ssc0000386.1
OG0031021
Physical Location & Seq
Forward (+)
179706 .. 180518
813 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_ssc0000386.1_g000036.1.cds

Sequence Viewer

Length: 813 bp
atgttcttcaaagattttgatattgaaaaggatgacttgatccaactatggatggctcaaggatggcttcacccttgtcctgacaaaggcctagacatggaggagagaggtaatgaatattttaaaatcctattggcgaagtcgttttttcaagacgctagaaaggattatggtggtaatgttaccaaatgtaagatgcacgatcttgtgcatgatcttgcagaaagtgtatcaaaatcaaggaacttacactcactttttctcaatggagaagtccttgaccttgagagcaacttacttaattttaaatctttacgtgtcttaaatttatacaatgcagacattatggagttgccaatttcaattgggaagttgaaacatttgaggtatctgaatgttttgaaaacaagaatcaaaacatttcccaaatcaattggtcaactttacaacctgcaaacattgaaaatagcttatcagcttgaagagtttccaagagaaattgcaaatttgatcaacttgcggcacatttattttggtagatatatgaaagttccaagtggaatattggggcggttcactaatcttcggtcattaccttttctcaaggtgggtaaagagacaggtccgagaattgaggaattgagtggtttaaaccagttgcagaacaccttgtctatttatggattggaaaatgtaagagatggagaagaagcgcagaaagcaaacttagttgagaagaaacatatacgcaagttaatccttgaatggaagcttgataggccaaggtggtgtttccttgccttgaggagctga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko03460 ko04014 map03460 map04014
Pfam Domains
Protein Families
NB-ARC

Protein Analysis

270

Amino Acids

31.56

Weight (kDa)

9.26

Isoelectric Point (pI)

39.57

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0031021)

Species Orthologous Gene IDs
rosa_multiflora Rmu_sc0006895.1_g000008 Rmu_ssc0000386.1_g000036

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 459
AciI CCGC 2 cut(s) 520, 571
AclWI GGATC 1 cut(s) 34
AcsI RAATTY 2 cut(s) 325, 505
AfiI CCNNNNNNNGG 2 cut(s) 86, 97
AflIII ACRYGT 1 cut(s) 316
AgsI TTSAA 9 cut(s) 10, 26, 152, 363, 376, 403, 463, 482, 764
AluBI AGCT 4 cut(s) 470, 478, 772, 810
AluI AGCT 4 cut(s) 470, 478, 772, 810
Alw26I GTCTC 1 cut(s) 611
AlwI GGATC 1 cut(s) 34
AoxI GGCC 2 cut(s) 88, 779
ApoI RAATTY 2 cut(s) 325, 505
Asp700I GAANNNNTTC 1 cut(s) 486
AspLEI GCGC 1 cut(s) 715
AspS9I GGNCC 1 cut(s) 623
AsuHPI GGTGA 1 cut(s) 62
AvaII GGWCC 1 cut(s) 623
BccI CCATC 3 cut(s) 46, 57, 695
BclI TGATCA 1 cut(s) 510
BcoDI GTCTC 1 cut(s) 611
BfaI CTAG 2 cut(s) 92, 159
BfuAI ACCTGC 1 cut(s) 459
BisI GCNGC 1 cut(s) 521
BlsI GCNGC 1 cut(s) 522
Bme18I GGWCC 1 cut(s) 623
BmgT120I GGNCC 1 cut(s) 623
BmsI GCATC 1 cut(s) 186
BpuEI CTTGAG 3 cut(s) 42, 305, 587
BsaAI YACGTR 1 cut(s) 317
BsaJI CCNNGG 1 cut(s) 782
Bsc4I CCNNNNNNNGG 2 cut(s) 86, 97
Bse1I ACTGG 1 cut(s) 655
BseDI CCNNGG 1 cut(s) 782
BseGI GGATG 3 cut(s) 37, 57, 68
BseLI CCNNNNNNNGG 2 cut(s) 86, 97
BseNI ACTGG 1 cut(s) 655
BseRI GAGGAG 1 cut(s) 116
BshFI GGCC 2 cut(s) 90, 781
BslI CCNNNNNNNGG 2 cut(s) 86, 97
BsmAI GTCTC 1 cut(s) 611
BsnI GGCC 2 cut(s) 90, 781
Bsp143I GATC 4 cut(s) 39, 202, 214, 510
BspACI CCGC 2 cut(s) 520, 571
BspANI GGCC 2 cut(s) 90, 781
BspMI ACCTGC 1 cut(s) 459
BspPI GGATC 1 cut(s) 34
BsrI ACTGG 1 cut(s) 655
BssECI CCNNGG 1 cut(s) 782
BssMI GATC 4 cut(s) 39, 202, 214, 510
BssT1I CCWWGG 1 cut(s) 782
Bst6I CTCTTC 1 cut(s) 477
BstBAI YACGTR 1 cut(s) 317
BstDEI CTNAG 1 cut(s) 727
BstENI CCTNNNNNAGG 1 cut(s) 84
BstF5I GGATG 3 cut(s) 37, 57, 68
BstHHI GCGC 1 cut(s) 715
BstKTI GATC 4 cut(s) 42, 205, 217, 513
BstMAI GTCTC 1 cut(s) 611
BstMBI GATC 4 cut(s) 39, 202, 214, 510
BstMWI GCNNNNNNNGC 2 cut(s) 719, 778
BsuRI GGCC 2 cut(s) 90, 781
BtsCI GGATG 3 cut(s) 37, 57, 68
BveI ACCTGC 1 cut(s) 459
CfoI GCGC 1 cut(s) 715
Cfr13I GGNCC 1 cut(s) 623
CseI GACGC 1 cut(s) 164
CviAII CATG 2 cut(s) 97, 212
CviJI RGCY 8 cut(s) 56, 67, 90, 470, 478, 772, 781, 810
CviKI_1 RGCY 8 cut(s) 56, 67, 90, 470, 478, 772, 781, 810
DdeI CTNAG 1 cut(s) 727
DpnI GATC 4 cut(s) 41, 204, 216, 512
DpnII GATC 4 cut(s) 39, 202, 214, 510
DraI TTTAAA 3 cut(s) 124, 307, 651
Eam1104I CTCTTC 1 cut(s) 477
EarI CTCTTC 1 cut(s) 477
Eco130I CCWWGG 1 cut(s) 782
Eco147I AGGCCT 1 cut(s) 90
Eco47I GGWCC 1 cut(s) 623
EcoNI CCTNNNNNAGG 1 cut(s) 84
EcoT14I CCWWGG 1 cut(s) 782
ErhI CCWWGG 1 cut(s) 782
FaeI CATG 2 cut(s) 100, 215
FalI AAGNNNNNCTT 4 cut(s) 20, 52, 51, 83
FatI CATG 2 cut(s) 96, 211
FbaI TGATCA 1 cut(s) 510
Fnu4HI GCNGC 1 cut(s) 521
FokI GGATG 3 cut(s) 44, 64, 75
Fsp4HI GCNGC 1 cut(s) 521
FspBI CTAG 2 cut(s) 92, 159
GlaI GCGC 1 cut(s) 714
GluI GCNGC 1 cut(s) 521
HaeIII GGCC 2 cut(s) 90, 781
HgaI GACGC 1 cut(s) 164
HhaI GCGC 1 cut(s) 715
Hin1II CATG 2 cut(s) 100, 215
Hin6I GCGC 1 cut(s) 713
HinP1I GCGC 1 cut(s) 713
HincII GTYRAC 1 cut(s) 440
HindII GTYRAC 1 cut(s) 440
HindIII AAGCTT 1 cut(s) 770
HinfI GANTC 1 cut(s) 411
HphI GGTGA 1 cut(s) 62
Hpy166II GTNNAC 2 cut(s) 440, 576
Hpy188I TCNGA 2 cut(s) 393, 627
Hpy188III TCNNGA 2 cut(s) 80, 152
Hpy8I GTNNAC 2 cut(s) 440, 576
HpyCH4IV ACGT 1 cut(s) 316
HpyCH4V TGCA 7 cut(s) 199, 211, 221, 338, 454, 503, 661
HpyF10VI GCNNNNNNNGC 2 cut(s) 719, 778
HpyF3I CTNAG 1 cut(s) 727
HpySE526I ACGT 1 cut(s) 316
Hsp92II CATG 2 cut(s) 100, 215
HspAI GCGC 1 cut(s) 713
Ksp22I TGATCA 1 cut(s) 510
Kzo9I GATC 4 cut(s) 39, 202, 214, 510
LmnI GCTCC 1 cut(s) 807
LpnPI CCDG 4 cut(s) 93, 464, 606, 668
LweI GCATC 1 cut(s) 186
MaeI CTAG 2 cut(s) 92, 159
MaeII ACGT 1 cut(s) 316
MaeIII GTNAC 1 cut(s) 181
MalI GATC 4 cut(s) 41, 204, 216, 512
MboI GATC 4 cut(s) 39, 202, 214, 510
MboII GAAGA 4 cut(s) 494, 575, 719, 748
MfeI CAATTG 2 cut(s) 363, 432
MluCI AATT 9 cut(s) 301, 325, 357, 363, 432, 498, 505, 630, 638
MmeI TCCRAC 1 cut(s) 67
MnlI CCTC 5 cut(s) 94, 101, 378, 628, 798
MroXI GAANNNNTTC 1 cut(s) 486
MseI TTAA 6 cut(s) 123, 300, 306, 323, 650, 755
MssI GTTTAAAC 1 cut(s) 651
MunI CAATTG 2 cut(s) 363, 432
MwoI GCNNNNNNNGC 2 cut(s) 719, 778
NdeII GATC 4 cut(s) 39, 202, 214, 510
NlaIII CATG 2 cut(s) 100, 215
PceI AGGCCT 1 cut(s) 90
PdmI GAANNNNTTC 1 cut(s) 486
PfeI GAWTC 1 cut(s) 411
PkrI GCNGC 1 cut(s) 522
PmeI GTTTAAAC 1 cut(s) 651
Ppu21I YACGTR 1 cut(s) 317
PspPI GGNCC 1 cut(s) 623
SaqAI TTAA 6 cut(s) 123, 300, 306, 323, 650, 755
SatI GCNGC 1 cut(s) 521
Sau3AI GATC 4 cut(s) 39, 202, 214, 510
Sau96I GGNCC 1 cut(s) 623
SfaNI GCATC 1 cut(s) 186
SinI GGWCC 1 cut(s) 623
SmlI CTYRAG 4 cut(s) 57, 284, 602, 802
SmoI CTYRAG 4 cut(s) 57, 284, 602, 802
Sse9I AATT 9 cut(s) 301, 325, 357, 363, 432, 498, 505, 630, 638
SseBI AGGCCT 1 cut(s) 90
SsiI CCGC 2 cut(s) 520, 571
SspI AATATT 2 cut(s) 119, 564
SspMI CTAG 2 cut(s) 92, 159
StuI AGGCCT 1 cut(s) 90
StyI CCWWGG 1 cut(s) 782
TaiI ACGT 1 cut(s) 319
TaqII GACCGA 1 cut(s) 576
TasI AATT 9 cut(s) 301, 325, 357, 363, 432, 498, 505, 630, 638
TauI GCSGC 1 cut(s) 523
TfiI GAWTC 1 cut(s) 411
Tru1I TTAA 6 cut(s) 123, 300, 306, 323, 650, 755
Tru9I TTAA 6 cut(s) 123, 300, 306, 323, 650, 755
TspDTI ATGAA 2 cut(s) 129, 560
VpaK11BI GGWCC 1 cut(s) 623
XagI CCTNNNNNAGG 1 cut(s) 84
XapI RAATTY 2 cut(s) 325, 505
XmnI GAANNNNTTC 1 cut(s) 486
XspI CTAG 2 cut(s) 92, 159
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.