Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0007766.1

Orthogroup ID

OG0021481

Physical Location & Seq

Genomic Coordinates Forward (+)

1 .. 1757

Gene Structure 1757 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0007766.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 527 bp

aactcaggcaaattctttttctgaaagtacctgagacaagaaaggcaatgttgctatctgaaattgatcgagtagctcaggattataaggttcatagagatgaaatacatacaaagttggttcagatcatgagagaaaggttattggttcatctacgtgggttgcctcaaattgtagagagctggaacagaccagaagatgctgacctacagcccagtcaatttgctcgatcacttaccaaggaagttggatacttgcaacgtgttctaactcgaactttacatgaggtcgatgttcaagcaattttcaggcaagtgattataatttttcattcacaaatttcagaagcattttcccgcttagagatcagcacaccacaagccaaggacaggctctgtcgtgatgttaagcacattcttggatgcattcgatctttgccttctgataaactgagtgaatctggtacgccaaactggggtcaactagatgaattcttggtgcagagatttgggtcagaagctagttaa

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0000139 GO:0000149 GO:0000938 GO:0001894 GO:0003674 GO:0005488 GO:0005515 GO:0005575 GO:0005622 GO:0005623 GO:0005634 GO:0005654 GO:0005737 GO:0005794 GO:0005802 GO:0006810 GO:0006892 GO:0006896 GO:0006996 GO:0007010 GO:0007034 GO:0007041 GO:0008150 GO:0009507 GO:0009536 GO:0009987 GO:0012505 GO:0016020 GO:0016043 GO:0016192 GO:0016197 GO:0016482 GO:0019905 GO:0031090 GO:0031410 GO:0031974 GO:0031981 GO:0031982 GO:0031984 GO:0032501 GO:0032588 GO:0032991 GO:0040008 GO:0042147 GO:0042592 GO:0043226 GO:0043227 GO:0043229 GO:0043231 GO:0043233 GO:0044422 GO:0044424 GO:0044428 GO:0044431 GO:0044433 GO:0044444 GO:0044446 GO:0044464 GO:0045103 GO:0045104 GO:0046907 GO:0048193 GO:0048471 GO:0048871 GO:0048872 GO:0048873 GO:0050789 GO:0050879 GO:0050881 GO:0051179 GO:0051234 GO:0051641 GO:0051649 GO:0060052 GO:0060249 GO:0065007 GO:0065008 GO:0070013 GO:0071840 GO:0097708 GO:0098588 GO:0098791 GO:0099023

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

Vps54

Protein Analysis

174

Amino Acids

20.21

Weight (kDa)

8.66

Isoelectric Point (pI)

46.11

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0021481)

Species	Orthologous Gene IDs
rosa_chinensis	RchiOBHm_Chr7g0240301
rosa_multiflora	Rmu_sc0007766.1_g000001
rosa_roxburghii	Rroxscaffold_3G00220230 Rroxscaffold_6G00426720
rosa_samantha	Rh1DG116500

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AanI	TTATAA	2 cut(s)	86, 322
AciI	CCGC	1 cut(s)	357
AcsI	RAATTY	3 cut(s)	11, 338, 490
AfaI	GTAC	2 cut(s)	29, 465
AfiI	CCNNNNNNNGG	2 cut(s)	389, 475
AflIII	ACRYGT	1 cut(s)	261
AgsI	TTSAA	1 cut(s)	298
AluBI	AGCT	3 cut(s)	76, 182, 520
AluI	AGCT	3 cut(s)	76, 182, 520
Alw26I	GTCTC	1 cut(s)	28
AlwNI	CAGNNNCTG	1 cut(s)	395
ApoI	RAATTY	3 cut(s)	11, 338, 490
BciVI	GTATCC	1 cut(s)	244
BcoDI	GTCTC	1 cut(s)	28
BfaI	CTAG	2 cut(s)	484, 521
BfmI	CTRYAG	1 cut(s)	208
BfuI	GTATCC	1 cut(s)	244
BmrI	ACTGGG	2 cut(s)	209, 483
BmsI	GCATC	2 cut(s)	189, 412
BmuI	ACTGGG	2 cut(s)	209, 483
Bpu10I	CCTNAGC	1 cut(s)	77
BsaAI	YACGTR	1 cut(s)	157
BsaJI	CCNNGG	2 cut(s)	239, 383
Bsc4I	CCNNNNNNNGG	2 cut(s)	389, 475
Bse1I	ACTGG	2 cut(s)	215, 478
Bse3DI	GCAATG	1 cut(s)	53
BseDI	CCNNGG	2 cut(s)	239, 383
BseGI	GGATG	1 cut(s)	427
BseLI	CCNNNNNNNGG	2 cut(s)	389, 475
BseMI	GCAATG	1 cut(s)	53
BseMII	CTCAG	4 cut(s)	18, 23, 91, 442
BseNI	ACTGG	2 cut(s)	215, 478
BsgI	GTGCAG	1 cut(s)	520
BslI	CCNNNNNNNGG	2 cut(s)	389, 475
BsmAI	GTCTC	1 cut(s)	28
BsmI	GAATGC	1 cut(s)	425
Bsp143I	GATC	5 cut(s)	66, 125, 229, 365, 430
BspACI	CCGC	1 cut(s)	357
BspCNI	CTCAG	4 cut(s)	17, 24, 90, 443
BspHI	TCATGA	1 cut(s)	128
BsrDI	GCAATG	1 cut(s)	53
BsrI	ACTGG	2 cut(s)	215, 478
BssECI	CCNNGG	2 cut(s)	239, 383
BssMI	GATC	5 cut(s)	66, 125, 229, 365, 430
BssT1I	CCWWGG	2 cut(s)	239, 383
BstBAI	YACGTR	1 cut(s)	157
BstDEI	CTNAG	5 cut(s)	4, 32, 77, 360, 451
BstF5I	GGATG	1 cut(s)	427
BstKTI	GATC	5 cut(s)	69, 128, 232, 368, 433
BstMAI	GTCTC	1 cut(s)	28
BstMBI	GATC	5 cut(s)	66, 125, 229, 365, 430
BstSFI	CTRYAG	1 cut(s)	208
BsuI	GTATCC	1 cut(s)	244
BtsCI	GGATG	1 cut(s)	427
CaiI	CAGNNNCTG	1 cut(s)	395
CciI	TCATGA	1 cut(s)	128
Csp6I	GTAC	2 cut(s)	28, 464
CviAII	CATG	2 cut(s)	129, 283
CviJI	RGCY	6 cut(s)	76, 182, 213, 382, 393, 520
CviKI_1	RGCY	6 cut(s)	76, 182, 213, 382, 393, 520
CviQI	GTAC	2 cut(s)	28, 464
DdeI	CTNAG	5 cut(s)	4, 32, 77, 360, 451
DpnI	GATC	5 cut(s)	68, 127, 231, 367, 432
DpnII	GATC	5 cut(s)	66, 125, 229, 365, 430
Eco130I	CCWWGG	2 cut(s)	239, 383
EcoRI	GAATTC	1 cut(s)	490
EcoT14I	CCWWGG	2 cut(s)	239, 383
EcoT22I	ATGCAT	1 cut(s)	427
ErhI	CCWWGG	2 cut(s)	239, 383
FaeI	CATG	2 cut(s)	132, 286
FaiI	YATR	6 cut(s)	86, 95, 110, 130, 284, 322
FatI	CATG	2 cut(s)	128, 282
FauI	CCCGC	1 cut(s)	364
FokI	GGATG	1 cut(s)	434
FspBI	CTAG	2 cut(s)	484, 521
Hin1II	CATG	2 cut(s)	132, 286
HincII	GTYRAC	1 cut(s)	481
HindII	GTYRAC	1 cut(s)	481
HinfI	GANTC	1 cut(s)	457
Hpy166II	GTNNAC	1 cut(s)	481
Hpy188I	TCNGA	6 cut(s)	23, 60, 125, 345, 444, 516
Hpy188III	TCNNGA	3 cut(s)	79, 129, 400
Hpy8I	GTNNAC	1 cut(s)	481
HpyAV	CCTTC	1 cut(s)	449
HpyCH4IV	ACGT	2 cut(s)	156, 261
HpyCH4V	TGCA	3 cut(s)	258, 425, 501
HpyF3I	CTNAG	5 cut(s)	4, 32, 77, 360, 451
HpySE526I	ACGT	2 cut(s)	156, 261
Hsp92II	CATG	2 cut(s)	132, 286
Kzo9I	GATC	5 cut(s)	66, 125, 229, 365, 430
LpnPI	CCDG	9 cut(s)	44, 64, 168, 206, 228, 294, 375, 446, 459
LweI	GCATC	2 cut(s)	189, 412
MaeI	CTAG	2 cut(s)	484, 521
MaeII	ACGT	2 cut(s)	156, 261
MalI	GATC	5 cut(s)	68, 127, 231, 367, 432
MboI	GATC	5 cut(s)	66, 125, 229, 365, 430
MboII	GAAGA	1 cut(s)	208
MluCI	AATT	8 cut(s)	11, 62, 170, 220, 302, 323, 338, 490
MmeI	TCCRAC	1 cut(s)	228
MnlI	CCTC	2 cut(s)	176, 279
Mph1103I	ATGCAT	1 cut(s)	427
MseI	TTAA	2 cut(s)	407, 525
MslI	CAYNNNNRTG	2 cut(s)	98, 155
Mva1269I	GAATGC	1 cut(s)	425
NdeII	GATC	5 cut(s)	66, 125, 229, 365, 430
NlaIII	CATG	2 cut(s)	132, 286
NsiI	ATGCAT	1 cut(s)	427
PagI	TCATGA	1 cut(s)	128
PctI	GAATGC	1 cut(s)	425
PfeI	GAWTC	1 cut(s)	457
Ppu21I	YACGTR	1 cut(s)	157
PsiI	TTATAA	2 cut(s)	86, 322
PstNI	CAGNNNCTG	1 cut(s)	395
RsaI	GTAC	2 cut(s)	29, 465
RsaNI	GTAC	2 cut(s)	28, 464
RseI	CAYNNNNRTG	2 cut(s)	98, 155
SaqAI	TTAA	2 cut(s)	407, 525
Sau3AI	GATC	5 cut(s)	66, 125, 229, 365, 430
SfaNI	GCATC	2 cut(s)	189, 412
SfcI	CTRYAG	1 cut(s)	208
SmiMI	CAYNNNNRTG	2 cut(s)	98, 155
Sse9I	AATT	8 cut(s)	11, 62, 170, 220, 302, 323, 338, 490
SsiI	CCGC	1 cut(s)	357
SspMI	CTAG	2 cut(s)	484, 521
StyI	CCWWGG	2 cut(s)	239, 383
TaiI	ACGT	2 cut(s)	159, 264
TaqI	TCGA	5 cut(s)	69, 228, 273, 290, 429
TasI	AATT	8 cut(s)	11, 62, 170, 220, 302, 323, 338, 490
TfiI	GAWTC	1 cut(s)	457
Tru1I	TTAA	2 cut(s)	407, 525
Tru9I	TTAA	2 cut(s)	407, 525
TspDTI	ATGAA	5 cut(s)	82, 116, 139, 319, 503
XapI	RAATTY	3 cut(s)	11, 338, 490
XspI	CTAG	2 cut(s)	484, 521
Zsp2I	ATGCAT	1 cut(s)	427

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.