Rmu_sc0008646.1_g000006

ADP binding

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0008646.1
OG0031090
Physical Location & Seq
Forward (+)
17861 .. 19362
1502 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0008646.1_g000006.1.cds

Sequence Viewer

Length: 975 bp
atgctaccaatggcttccagcaggaaagccgatgaagcctcctcaaatcattggatttacgaggaggctggaatcaatgctttcaatgaaaacaatgaactgaagaggggagagattatagatgaggaactggtgcaggcaatcaaagggtccaaaatctgtgtcatcgtcttctcaaggaggtatgcagattccagttggtgtcttgaggagctagtgaagatcatggagtgtagaagaacaatggggcaactagtctttccagtattctatgatgttgatccttcagatgtccggaaacaggggggtagttttgcagaggcgtttgatcagaaacatggagacaaagatgaagataaggtgaagaggtggagagctggtctcactgaagctgcaaatttgtctggctgggatcttagaaccaaaggtgatggtcatgtagagctcactggaggctacaaatatctccccaacaagttaagatggctccactggactgcattccctctaaagttcatgccaaaagattttaatctaggagaagcagttgctctctacctgcaaggtagcaacctcagatacgtttgggaagattctggggtccttgcgaaattgaagattcttgatctcagctattcctattccttaaaacaatcaccagacttttcaactattccaaatctcgaggattttgtccttgaaagctgttggcaattggcagaggttcaacagtccattggaggactgaaaaggctttctgtcattaatctcaggggctgcaaagttcttgaggagcttccaaggagtttctataagttaagatctatagttaatcttgttcttgatggctgtaaaagatttgagaaattggatcaggaaataggggacatgacatcgttgtctactctgcatgcaaatgaaacagccatatataacagaactgccgtcttccattgtgagattgaagaaccttag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko04014 ko04016 ko04075 ko04931 map04014 map04016 map04075 map04931
Pfam Domains
Protein Families
LRR_8 NB-ARC TIR

Protein Analysis

324

Amino Acids

37.01

Weight (kDa)

5.55

Isoelectric Point (pI)

55.13

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0031090)

Species Orthologous Gene IDs
rosa_multiflora Rmu_sc0000706.1_g000007 Rmu_sc0008646.1_g000006

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AasI GACNNNNNNGTC 1 cut(s) 898
Acc36I ACCTGC 1 cut(s) 567
AccI GTMKAC 1 cut(s) 902
AccIII TCCGGA 1 cut(s) 294
AclWI GGATC 3 cut(s) 275, 420, 879
AcsI RAATTY 1 cut(s) 397
AcuI CTGAAG 3 cut(s) 122, 270, 408
AfiI CCNNNNNNNGG 1 cut(s) 301
AgsI TTSAA 6 cut(s) 85, 616, 669, 701, 728, 965
AhlI ACTAGT 1 cut(s) 253
AluBI AGCT 7 cut(s) 214, 377, 392, 445, 633, 705, 796
AluI AGCT 7 cut(s) 214, 377, 392, 445, 633, 705, 796
Alw21I GWGCWC 1 cut(s) 447
Alw26I GTCTC 2 cut(s) 336, 386
AlwI GGATC 3 cut(s) 275, 420, 879
AlwNI CAGNNNCTG 1 cut(s) 777
Ama87I CYCGRG 1 cut(s) 683
Aor13HI TCCGGA 1 cut(s) 294
ApeKI GCWGC 2 cut(s) 392, 777
ApoI RAATTY 1 cut(s) 397
ArsI GACNNNNNNTTYG 2 cut(s) 147, 179
AseI ATTAAT 1 cut(s) 765
AspS9I GGNCC 2 cut(s) 150, 601
AsuHPI GGTGA 3 cut(s) 373, 440, 648
AvaI CYCGRG 1 cut(s) 683
AvaII GGWCC 2 cut(s) 150, 601
BanII GRGCYC 1 cut(s) 447
BbsI GAAGAC 2 cut(s) 163, 940
Bbv12I GWGCWC 1 cut(s) 447
BbvI GCAGC 2 cut(s) 379, 764
BccI CCATC 3 cut(s) 425, 477, 839
BceAI ACGGC 1 cut(s) 929
BclI TGATCA 1 cut(s) 328
BcoDI GTCTC 2 cut(s) 336, 386
BcuI ACTAGT 1 cut(s) 253
BfaI CTAG 3 cut(s) 215, 254, 536
BfmI CTRYAG 1 cut(s) 825
BfuAI ACCTGC 1 cut(s) 567
BglII AGATCT 1 cut(s) 821
BisI GCNGC 2 cut(s) 393, 778
BlsI GCNGC 2 cut(s) 394, 779
Bme18I GGWCC 2 cut(s) 150, 601
BmeT110I CYCGRG 1 cut(s) 683
BmgT120I GGNCC 2 cut(s) 150, 601
BmiI GGNNCC 3 cut(s) 151, 488, 602
BpiI GAAGAC 2 cut(s) 163, 940
BplI GAGNNNNNCTC 2 cut(s) 366, 398
BpmI CTGGAG 1 cut(s) 471
BpuEI CTTGAG 3 cut(s) 160, 227, 809
BsaBI GATNNNNATC 2 cut(s) 279, 531
BsaI GGTCTC 1 cut(s) 386
BsaJI CCNNGG 1 cut(s) 800
BsaWI WCCGGW 1 cut(s) 294
BsaXI ACNNNNNCTCC 4 cut(s) 364, 394, 531, 561
Bsc4I CCNNNNNNNGG 1 cut(s) 301
Bse1I ACTGG 5 cut(s) 135, 195, 263, 454, 497
Bse8I GATNNNNATC 2 cut(s) 279, 531
BseAI TCCGGA 1 cut(s) 294
BseDI CCNNGG 1 cut(s) 800
BseJI GATNNNNATC 2 cut(s) 279, 531
BseLI CCNNNNNNNGG 1 cut(s) 301
BseMII CTCAG 3 cut(s) 589, 643, 784
BseNI ACTGG 5 cut(s) 135, 195, 263, 454, 497
BseRI GAGGAG 4 cut(s) 31, 77, 224, 806
BseXI GCAGC 2 cut(s) 379, 764
BseYI CCCAGC 1 cut(s) 408
BsgI GTGCAG 1 cut(s) 155
BsiHKAI GWGCWC 1 cut(s) 447
BsiHKCI CYCGRG 1 cut(s) 683
BsiSI CCGG 1 cut(s) 295
BslFI GGGAC 1 cut(s) 899
BslI CCNNNNNNNGG 1 cut(s) 301
BsmAI GTCTC 2 cut(s) 336, 386
BsmFI GGGAC 1 cut(s) 899
BsmI GAATGC 1 cut(s) 500
Bso31I GGTCTC 1 cut(s) 386
BsoBI CYCGRG 1 cut(s) 683
Bsp1286I GDGCHC 1 cut(s) 447
Bsp13I TCCGGA 1 cut(s) 294
Bsp143I GATC 7 cut(s) 222, 280, 328, 412, 625, 821, 871
BspCNI CTCAG 3 cut(s) 588, 642, 783
BspEI TCCGGA 1 cut(s) 294
BspLI GGNNCC 3 cut(s) 151, 488, 602
BspMI ACCTGC 1 cut(s) 567
BspPI GGATC 3 cut(s) 275, 420, 879
BspTNI GGTCTC 1 cut(s) 386
BsrI ACTGG 5 cut(s) 135, 195, 263, 454, 497
BssECI CCNNGG 1 cut(s) 800
BssMI GATC 7 cut(s) 222, 280, 328, 412, 625, 821, 871
BssT1I CCWWGG 1 cut(s) 800
Bst4CI ACNGT 1 cut(s) 732
Bst6I CTCTTC 2 cut(s) 98, 359
BstC8I GCNNGC 2 cut(s) 138, 912
BstDEI CTNAG 5 cut(s) 416, 575, 629, 770, 972
BstKTI GATC 7 cut(s) 225, 283, 331, 415, 628, 824, 874
BstMAI GTCTC 2 cut(s) 336, 386
BstMBI GATC 7 cut(s) 222, 280, 328, 412, 625, 821, 871
BstMWI GCNNNNNNNGC 1 cut(s) 35
BstNSI RCATGY 1 cut(s) 914
BstSFI CTRYAG 1 cut(s) 825
BstV1I GCAGC 2 cut(s) 379, 764
BstV2I GAAGAC 2 cut(s) 163, 940
BstX2I RGATCY 2 cut(s) 412, 821
BstYI RGATCY 2 cut(s) 412, 821
BtsIMutI CAGTG 3 cut(s) 384, 447, 490
BveI ACCTGC 1 cut(s) 567
Cac8I GCNNGC 2 cut(s) 138, 912
CaiI CAGNNNCTG 1 cut(s) 777
Cfr13I GGNCC 2 cut(s) 150, 601
CviAII CATG 6 cut(s) 226, 338, 437, 517, 889, 911
DdeI CTNAG 5 cut(s) 416, 575, 629, 770, 972
DpnI GATC 7 cut(s) 224, 282, 330, 414, 627, 823, 873
DpnII GATC 7 cut(s) 222, 280, 328, 412, 625, 821, 871
DrdI GACNNNNNNGTC 1 cut(s) 898
DseDI GACNNNNNNGTC 1 cut(s) 898
Eam1104I CTCTTC 2 cut(s) 98, 359
EarI CTCTTC 2 cut(s) 98, 359
Ecl136II GAGCTC 1 cut(s) 445
Eco130I CCWWGG 1 cut(s) 800
Eco24I GRGCYC 1 cut(s) 447
Eco31I GGTCTC 1 cut(s) 386
Eco47I GGWCC 2 cut(s) 150, 601
Eco53kI GAGCTC 1 cut(s) 445
Eco57I CTGAAG 3 cut(s) 122, 270, 408
Eco88I CYCGRG 1 cut(s) 683
EcoICRI GAGCTC 1 cut(s) 445
EcoO109I RGGNCCY 1 cut(s) 601
EcoT14I CCWWGG 1 cut(s) 800
EcoT38I GRGCYC 1 cut(s) 447
ErhI CCWWGG 1 cut(s) 800
FaeI CATG 6 cut(s) 229, 341, 440, 520, 892, 914
FaqI GGGAC 1 cut(s) 899
FatI CATG 6 cut(s) 225, 337, 436, 516, 888, 910
FbaI TGATCA 1 cut(s) 328
FblI GTMKAC 1 cut(s) 902
Fnu4HI GCNGC 2 cut(s) 393, 778
FriOI GRGCYC 1 cut(s) 447
Fsp4HI GCNGC 2 cut(s) 393, 778
FspBI CTAG 3 cut(s) 215, 254, 536
GluI GCNGC 2 cut(s) 393, 778
GsaI CCCAGC 1 cut(s) 412
GsuI CTGGAG 1 cut(s) 471
HapII CCGG 1 cut(s) 295
Hin1II CATG 6 cut(s) 229, 341, 440, 520, 892, 914
HinfI GANTC 4 cut(s) 72, 191, 593, 619
HpaII CCGG 1 cut(s) 295
HphI GGTGA 3 cut(s) 373, 440, 648
Hpy166II GTNNAC 1 cut(s) 903
Hpy188I TCNGA 3 cut(s) 289, 333, 578
Hpy188III TCNNGA 7 cut(s) 206, 295, 623, 683, 788, 842, 875
Hpy8I GTNNAC 1 cut(s) 903
HpyAV CCTTC 1 cut(s) 294
HpyCH4III ACNGT 1 cut(s) 732
HpyCH4IV ACGT 1 cut(s) 582
HpyCH4V TGCA 9 cut(s) 136, 188, 317, 395, 500, 562, 780, 910, 914
HpyF10VI GCNNNNNNNGC 1 cut(s) 35
HpyF3I CTNAG 5 cut(s) 416, 575, 629, 770, 972
HpySE526I ACGT 1 cut(s) 582
Hsp92II CATG 6 cut(s) 229, 341, 440, 520, 892, 914
Kpn2I TCCGGA 1 cut(s) 294
Ksp22I TGATCA 1 cut(s) 328
Kzo9I GATC 7 cut(s) 222, 280, 328, 412, 625, 821, 871
LmnI GCTCC 3 cut(s) 211, 492, 793
Lsp1109I GCAGC 2 cut(s) 379, 764
MaeI CTAG 3 cut(s) 215, 254, 536
MaeII ACGT 1 cut(s) 582
MalI GATC 7 cut(s) 224, 282, 330, 414, 627, 823, 873
MboI GATC 7 cut(s) 222, 280, 328, 412, 625, 821, 871
MboII GAAGA 9 cut(s) 115, 163, 232, 249, 365, 376, 602, 628, 940
MfeI CAATTG 1 cut(s) 713
MflI RGATCY 2 cut(s) 412, 821
MhlI GDGCHC 1 cut(s) 447
MluCI AATT 4 cut(s) 397, 611, 713, 866
MroI TCCGGA 1 cut(s) 294
MseI TTAA 6 cut(s) 479, 531, 647, 765, 818, 831
MslI CAYNNNNRTG 1 cut(s) 915
MspI CCGG 1 cut(s) 295
MunI CAATTG 1 cut(s) 713
Mva1269I GAATGC 1 cut(s) 500
MwoI GCNNNNNNNGC 1 cut(s) 35
NdeII GATC 7 cut(s) 222, 280, 328, 412, 625, 821, 871
NlaIII CATG 6 cut(s) 229, 341, 440, 520, 892, 914
NlaIV GGNNCC 3 cut(s) 151, 488, 602
NspI RCATGY 1 cut(s) 914
PaeI GCATGC 1 cut(s) 914
PaeR7I CTCGAG 1 cut(s) 683
PctI GAATGC 1 cut(s) 500
PfeI GAWTC 4 cut(s) 72, 191, 593, 619
PkrI GCNGC 2 cut(s) 394, 779
PpuMI RGGWCCY 1 cut(s) 601
PshBI ATTAAT 1 cut(s) 765
Psp124BI GAGCTC 1 cut(s) 447
Psp5II RGGWCCY 1 cut(s) 601
PspFI CCCAGC 1 cut(s) 408
PspN4I GGNNCC 3 cut(s) 151, 488, 602
PspPI GGNCC 2 cut(s) 150, 601
PspPPI RGGWCCY 1 cut(s) 601
PstNI CAGNNNCTG 1 cut(s) 777
PsuI RGATCY 2 cut(s) 412, 821
RseI CAYNNNNRTG 1 cut(s) 915
SacI GAGCTC 1 cut(s) 447
SaqAI TTAA 6 cut(s) 479, 531, 647, 765, 818, 831
SatI GCNGC 2 cut(s) 393, 778
Sau3AI GATC 7 cut(s) 222, 280, 328, 412, 625, 821, 871
Sau96I GGNCC 2 cut(s) 150, 601
SduI GDGCHC 1 cut(s) 447
SfcI CTRYAG 1 cut(s) 825
Sfr274I CTCGAG 1 cut(s) 683
SinI GGWCC 2 cut(s) 150, 601
SlaI CTCGAG 1 cut(s) 683
SmiMI CAYNNNNRTG 1 cut(s) 915
SmlI CTYRAG 4 cut(s) 175, 206, 683, 788
SmoI CTYRAG 4 cut(s) 175, 206, 683, 788
SpeI ACTAGT 1 cut(s) 253
SphI GCATGC 1 cut(s) 914
Sse9I AATT 4 cut(s) 397, 611, 713, 866
SspMI CTAG 3 cut(s) 215, 254, 536
SstI GAGCTC 1 cut(s) 447
StyI CCWWGG 1 cut(s) 800
TaaI ACNGT 1 cut(s) 732
TaiI ACGT 1 cut(s) 585
TaqI TCGA 1 cut(s) 684
TasI AATT 4 cut(s) 397, 611, 713, 866
TfiI GAWTC 4 cut(s) 72, 191, 593, 619
Tru1I TTAA 6 cut(s) 479, 531, 647, 765, 818, 831
Tru9I TTAA 6 cut(s) 479, 531, 647, 765, 818, 831
TscAI CASTG 3 cut(s) 391, 454, 497
TseI GCWGC 2 cut(s) 392, 777
TspDTI ATGAA 6 cut(s) 48, 102, 111, 366, 505, 933
TspRI CASTG 3 cut(s) 391, 454, 497
VpaK11BI GGWCC 2 cut(s) 150, 601
VspI ATTAAT 1 cut(s) 765
XapI RAATTY 1 cut(s) 397
XceI RCATGY 1 cut(s) 914
XhoI CTCGAG 1 cut(s) 683
XmiI GTMKAC 1 cut(s) 902
XspI CTAG 3 cut(s) 215, 254, 536
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.