Rmu_sc0009451.1_g000003

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0009451.1
OG0031119
Physical Location & Seq
Forward (+)
11031 .. 11763
733 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0009451.1_g000003.1.cds

Sequence Viewer

Length: 570 bp
atggaaactgcctttgtggcaaaagactacactgccaccattactgatcccacaaatgatgaactatctaataaggtgaaagcagatgccttaatttttctgaggcgacatattgatcctagcctacgctgggagtactttcaattgaagacacccaaagcactgtgggatgcccttaaaggacgttttgggaacattcacgatactttgctcccaggactggctgttcagtggaatggaatccgcttgcttgactataaaaagttgataagcctactgcaagtggctgagagacaaaataagattctcttgaataacaatgccaggcccactgggacaaagaaaattcccgaggctgattatggaaaaatgaaaggtggaaataactccaatgtaagggggtttagacgtgttgatccctacccacgtggcaaccatgcaccacgtggaaagggacatggggatatcatggaaacaagatgcaaaaggaaagagttgacaatgaaccatgctttaggtgtggattcattgggcattggtacaagaactgtcaagcaaacaacagagtag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Retrotran_gag_2 zf-CCHC

Protein Analysis

189

Amino Acids

21.35

Weight (kDa)

9.92

Isoelectric Point (pI)

30.76

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0031119)

Species Orthologous Gene IDs
rosa_multiflora Rmu_sc0001207.1_g000006 Rmu_sc0009451.1_g000003

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 244
AclWI GGATC 3 cut(s) 41, 110, 410
AcsI RAATTY 1 cut(s) 345
AcvI CACGTG 2 cut(s) 428, 446
AdeI CACNNNGTG 1 cut(s) 446
AfaI GTAC 2 cut(s) 137, 541
AfiI CCNNNNNNNGG 3 cut(s) 130, 220, 396
AflIII ACRYGT 1 cut(s) 409
AgsI TTSAA 3 cut(s) 143, 148, 313
AjiI CACGTC 1 cut(s) 410
AjnI CCWGG 2 cut(s) 214, 323
AloI GAACNNNNNNTCC 2 cut(s) 210, 242
Alw26I GTCTC 1 cut(s) 286
AlwI GGATC 3 cut(s) 41, 110, 410
Ama87I CYCGRG 1 cut(s) 350
AoxI GGCC 1 cut(s) 326
ApoI RAATTY 1 cut(s) 345
AspS9I GGNCC 1 cut(s) 327
AsuHPI GGTGA 1 cut(s) 88
AvaI CYCGRG 1 cut(s) 350
BbrPI CACGTG 2 cut(s) 428, 446
BbsI GAAGAC 1 cut(s) 155
BciT130I CCWGG 2 cut(s) 216, 325
BcoDI GTCTC 1 cut(s) 286
BfaI CTAG 1 cut(s) 120
BglI GCCNNNNNGGC 1 cut(s) 17
BmcAI AGTACT 1 cut(s) 137
Bme1390I CCNGG 2 cut(s) 216, 325
BmeT110I CYCGRG 1 cut(s) 350
BmgBI CACGTC 1 cut(s) 410
BmgT120I GGNCC 1 cut(s) 327
BmrFI CCNGG 2 cut(s) 216, 325
BmrI ACTGGG 1 cut(s) 342
BmsI GCATC 3 cut(s) 76, 160, 470
BmuI ACTGGG 1 cut(s) 342
BpiI GAAGAC 1 cut(s) 155
BsaAI YACGTR 2 cut(s) 428, 446
BsaJI CCNNGG 2 cut(s) 214, 351
Bsc4I CCNNNNNNNGG 3 cut(s) 130, 220, 396
Bse1I ACTGG 2 cut(s) 225, 337
BseBI CCWGG 2 cut(s) 216, 325
BseDI CCNNGG 2 cut(s) 214, 351
BseGI GGATG 1 cut(s) 175
BseLI CCNNNNNNNGG 3 cut(s) 130, 220, 396
BseMII CTCAG 2 cut(s) 92, 279
BseNI ACTGG 2 cut(s) 225, 337
BseYI CCCAGC 1 cut(s) 129
BshFI GGCC 1 cut(s) 328
BsiHKCI CYCGRG 1 cut(s) 350
BslFI GGGAC 2 cut(s) 349, 468
BslI CCNNNNNNNGG 3 cut(s) 130, 220, 396
BsmAI GTCTC 1 cut(s) 286
BsmFI GGGAC 2 cut(s) 349, 468
BsnI GGCC 1 cut(s) 328
BsoBI CYCGRG 1 cut(s) 350
Bsp143I GATC 3 cut(s) 46, 115, 415
BspACI CCGC 1 cut(s) 244
BspANI GGCC 1 cut(s) 328
BspCNI CTCAG 2 cut(s) 93, 280
BspPI GGATC 3 cut(s) 41, 110, 410
BsrI ACTGG 2 cut(s) 225, 337
BssECI CCNNGG 2 cut(s) 214, 351
BssMI GATC 3 cut(s) 46, 115, 415
Bst2UI CCWGG 2 cut(s) 216, 325
Bst4CI ACNGT 2 cut(s) 165, 550
BstBAI YACGTR 2 cut(s) 428, 446
BstC8I GCNNGC 1 cut(s) 248
BstDEI CTNAG 2 cut(s) 101, 288
BstF5I GGATG 1 cut(s) 175
BstKTI GATC 3 cut(s) 49, 118, 418
BstMAI GTCTC 1 cut(s) 286
BstMBI GATC 3 cut(s) 46, 115, 415
BstMWI GCNNNNNNNGC 1 cut(s) 17
BstNI CCWGG 2 cut(s) 216, 325
BstSCI CCNGG 2 cut(s) 214, 323
BstV2I GAAGAC 1 cut(s) 155
BsuRI GGCC 1 cut(s) 328
BtrI CACGTC 1 cut(s) 410
BtsCI GGATG 1 cut(s) 175
BtsI GCAGTG 1 cut(s) 30
BtsIMutI CAGTG 4 cut(s) 30, 161, 236, 330
Cac8I GCNNGC 1 cut(s) 248
Cfr13I GGNCC 1 cut(s) 327
Csp6I GTAC 2 cut(s) 136, 540
CviAII CATG 4 cut(s) 437, 458, 469, 509
CviJI RGCY 6 cut(s) 123, 224, 273, 287, 328, 356
CviKI_1 RGCY 6 cut(s) 123, 224, 273, 287, 328, 356
CviQI GTAC 2 cut(s) 136, 540
DdeI CTNAG 2 cut(s) 101, 288
DpnI GATC 3 cut(s) 48, 117, 417
DpnII GATC 3 cut(s) 46, 115, 415
DraIII CACNNNGTG 1 cut(s) 446
Eco32I GATATC 1 cut(s) 466
Eco72I CACGTG 2 cut(s) 428, 446
Eco88I CYCGRG 1 cut(s) 350
EcoRII CCWGG 2 cut(s) 214, 323
EcoRV GATATC 1 cut(s) 466
FaeI CATG 4 cut(s) 440, 461, 472, 512
FaiI YATR 7 cut(s) 111, 258, 363, 438, 459, 470, 510
FalI AAGNNNNNCTT 2 cut(s) 293, 325
FaqI GGGAC 2 cut(s) 349, 468
FatI CATG 4 cut(s) 436, 457, 468, 508
FokI GGATG 1 cut(s) 182
FspBI CTAG 1 cut(s) 120
GsaI CCCAGC 1 cut(s) 133
HaeIII GGCC 1 cut(s) 328
Hin1II CATG 4 cut(s) 440, 461, 472, 512
HincII GTYRAC 1 cut(s) 498
HindII GTYRAC 1 cut(s) 498
HinfI GANTC 3 cut(s) 240, 304, 524
HphI GGTGA 1 cut(s) 88
Hpy166II GTNNAC 1 cut(s) 498
Hpy188I TCNGA 1 cut(s) 102
Hpy188III TCNNGA 3 cut(s) 200, 310, 350
Hpy8I GTNNAC 1 cut(s) 498
HpyCH4III ACNGT 2 cut(s) 165, 550
HpyCH4IV ACGT 4 cut(s) 184, 409, 427, 445
HpyCH4V TGCA 3 cut(s) 280, 440, 483
HpyF10VI GCNNNNNNNGC 1 cut(s) 17
HpyF3I CTNAG 2 cut(s) 101, 288
HpySE526I ACGT 4 cut(s) 184, 409, 427, 445
Hsp92II CATG 4 cut(s) 440, 461, 472, 512
Kzo9I GATC 3 cut(s) 46, 115, 415
LmnI GCTCC 1 cut(s) 216
LpnPI CCDG 7 cut(s) 115, 201, 206, 228, 310, 318, 337
LweI GCATC 3 cut(s) 76, 160, 470
MaeI CTAG 1 cut(s) 120
MaeII ACGT 4 cut(s) 184, 409, 427, 445
MalI GATC 3 cut(s) 48, 117, 417
MboI GATC 3 cut(s) 46, 115, 415
MboII GAAGA 1 cut(s) 160
MfeI CAATTG 1 cut(s) 143
MluCI AATT 3 cut(s) 93, 143, 345
MnlI CCTC 2 cut(s) 96, 346
MseI TTAA 2 cut(s) 92, 177
MspR9I CCNGG 2 cut(s) 216, 325
MunI CAATTG 1 cut(s) 143
MvaI CCWGG 2 cut(s) 216, 325
MwoI GCNNNNNNNGC 1 cut(s) 17
NdeII GATC 3 cut(s) 46, 115, 415
NlaIII CATG 4 cut(s) 440, 461, 472, 512
PfeI GAWTC 3 cut(s) 240, 304, 524
PmaCI CACGTG 2 cut(s) 428, 446
PmlI CACGTG 2 cut(s) 428, 446
Ppu21I YACGTR 2 cut(s) 428, 446
Psp6I CCWGG 2 cut(s) 214, 323
PspCI CACGTG 2 cut(s) 428, 446
PspFI CCCAGC 1 cut(s) 129
PspGI CCWGG 2 cut(s) 214, 323
PspPI GGNCC 1 cut(s) 327
RsaI GTAC 2 cut(s) 137, 541
RsaNI GTAC 2 cut(s) 136, 540
SaqAI TTAA 2 cut(s) 92, 177
Sau3AI GATC 3 cut(s) 46, 115, 415
Sau96I GGNCC 1 cut(s) 327
ScaI AGTACT 1 cut(s) 137
ScrFI CCNGG 2 cut(s) 216, 325
SetI ASST 7 cut(s) 78, 187, 379, 412, 430, 448, 520
SfaNI GCATC 3 cut(s) 76, 160, 470
Sse9I AATT 3 cut(s) 93, 143, 345
SsiI CCGC 1 cut(s) 244
SspMI CTAG 1 cut(s) 120
StyD4I CCNGG 2 cut(s) 214, 323
TaaI ACNGT 2 cut(s) 165, 550
TaiI ACGT 4 cut(s) 187, 412, 430, 448
TasI AATT 3 cut(s) 93, 143, 345
TatI WGTACW 1 cut(s) 135
TfiI GAWTC 3 cut(s) 240, 304, 524
Tru1I TTAA 2 cut(s) 92, 177
Tru9I TTAA 2 cut(s) 92, 177
TscAI CASTG 4 cut(s) 37, 168, 236, 337
TspDTI ATGAA 4 cut(s) 75, 386, 516, 518
TspRI CASTG 4 cut(s) 37, 168, 236, 337
XapI RAATTY 1 cut(s) 345
XcmI CCANNNNNNNNNTGG 1 cut(s) 443
XspI CTAG 1 cut(s) 120
ZrmI AGTACT 1 cut(s) 137
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.