Rmu_sc0011151.1_g000002

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0011151.1
OG0030998
Physical Location & Seq
Forward (+)
2484 .. 3011
528 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0011151.1_g000002.1.cds

Sequence Viewer

Length: 411 bp
atgcccgatccgaacaggcaatatctccagatatcagcgacatctagcggcaccgcctgtccatatcaattcgtctgcccttcctcctcctctttctggcactcttcggcattgacttgcactagaaactgcaaatcgaagcaagggaagtcggcgacagcaggcatgccacttctctgttttccagcggtggttcggcttgaaaccgccttcgatcttgatcctggcctaactagccttagccccaggtatgaaagttgcttctctcacctagatcttcattctagacggttggatcgacctcgtttagaggttgacactgcgacatgtggggctcatgtgcagcctcttgtggagcaaatccttacttcattattatctattcatcgttacgagcattttgatatatag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

136

Amino Acids

15.12

Weight (kDa)

6.98

Isoelectric Point (pI)

53.66

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0030998)

Species Orthologous Gene IDs
rosa_multiflora Rmu_sc0011151.1_g000002 Rmu_ssc0000019.1_g000017

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 50
AciI CCGC 4 cut(s) 48, 54, 188, 207
AclWI GGATC 3 cut(s) 2, 215, 303
AfiI CCNNNNNNNGG 1 cut(s) 96
AflIII ACRYGT 1 cut(s) 326
AgsI TTSAA 1 cut(s) 203
AjnI CCWGG 2 cut(s) 223, 245
AlwI GGATC 3 cut(s) 2, 215, 303
AoxI GGCC 1 cut(s) 226
ApeKI GCWGC 1 cut(s) 343
AsuHPI GGTGA 1 cut(s) 260
BanI GGYRCC 1 cut(s) 50
BanII GRGCYC 1 cut(s) 337
BbvI GCAGC 1 cut(s) 355
BciT130I CCWGG 2 cut(s) 225, 247
BfaI CTAG 5 cut(s) 45, 123, 234, 272, 285
BglII AGATCT 1 cut(s) 274
BisI GCNGC 2 cut(s) 49, 344
BlsI GCNGC 2 cut(s) 50, 345
Bme1390I CCNGG 2 cut(s) 225, 247
BmiI GGNNCC 1 cut(s) 52
BmrFI CCNGG 2 cut(s) 225, 247
BpmI CTGGAG 1 cut(s) 11
Bpu10I CCTNAGC 1 cut(s) 239
BsaBI GATNNNNATC 1 cut(s) 219
BsaJI CCNNGG 1 cut(s) 245
Bsc4I CCNNNNNNNGG 1 cut(s) 96
Bse8I GATNNNNATC 1 cut(s) 219
BseBI CCWGG 2 cut(s) 225, 247
BseDI CCNNGG 1 cut(s) 245
BseJI GATNNNNATC 1 cut(s) 219
BseLI CCNNNNNNNGG 1 cut(s) 96
BseRI GAGGAG 2 cut(s) 76, 79
BseXI GCAGC 1 cut(s) 355
BsgI GTGCAG 1 cut(s) 362
BshFI GGCC 1 cut(s) 228
BshNI GGYRCC 1 cut(s) 50
BslI CCNNNNNNNGG 1 cut(s) 96
BsnI GGCC 1 cut(s) 228
Bsp1286I GDGCHC 1 cut(s) 337
Bsp143I GATC 5 cut(s) 7, 214, 220, 274, 295
BspACI CCGC 4 cut(s) 48, 54, 188, 207
BspANI GGCC 1 cut(s) 228
BspLI GGNNCC 1 cut(s) 52
BspPI GGATC 3 cut(s) 2, 215, 303
BspT107I GGYRCC 1 cut(s) 50
BssECI CCNNGG 1 cut(s) 245
BssMI GATC 5 cut(s) 7, 214, 220, 274, 295
Bst2UI CCWGG 2 cut(s) 225, 247
Bst4CI ACNGT 1 cut(s) 291
Bst6I CTCTTC 1 cut(s) 109
BstC8I GCNNGC 2 cut(s) 163, 167
BstDEI CTNAG 1 cut(s) 239
BstKTI GATC 5 cut(s) 10, 217, 223, 277, 298
BstMBI GATC 5 cut(s) 7, 214, 220, 274, 295
BstMWI GCNNNNNNNGC 1 cut(s) 234
BstNI CCWGG 2 cut(s) 225, 247
BstNSI RCATGY 2 cut(s) 169, 330
BstSCI CCNGG 2 cut(s) 223, 245
BstV1I GCAGC 1 cut(s) 355
BstX2I RGATCY 1 cut(s) 274
BstYI RGATCY 1 cut(s) 274
BsuRI GGCC 1 cut(s) 228
BtsI GCAGTG 1 cut(s) 318
BtsIMutI CAGTG 1 cut(s) 318
Cac8I GCNNGC 2 cut(s) 163, 167
CviAII CATG 3 cut(s) 166, 327, 338
CviJI RGCY 6 cut(s) 199, 228, 237, 243, 335, 346
CviKI_1 RGCY 6 cut(s) 199, 228, 237, 243, 335, 346
DdeI CTNAG 1 cut(s) 239
DpnI GATC 5 cut(s) 9, 216, 222, 276, 297
DpnII GATC 5 cut(s) 7, 214, 220, 274, 295
Eam1104I CTCTTC 1 cut(s) 109
EarI CTCTTC 1 cut(s) 109
Eco24I GRGCYC 1 cut(s) 337
Eco32I GATATC 1 cut(s) 33
EcoRII CCWGG 2 cut(s) 223, 245
EcoRV GATATC 1 cut(s) 33
EcoT38I GRGCYC 1 cut(s) 337
FaeI CATG 3 cut(s) 169, 330, 341
FaiI YATR 7 cut(s) 64, 167, 252, 328, 339, 407, 409
FatI CATG 3 cut(s) 165, 326, 337
Fnu4HI GCNGC 2 cut(s) 49, 344
FriOI GRGCYC 1 cut(s) 337
Fsp4HI GCNGC 2 cut(s) 49, 344
FspBI CTAG 5 cut(s) 45, 123, 234, 272, 285
GluI GCNGC 2 cut(s) 49, 344
GsuI CTGGAG 1 cut(s) 11
HaeIII GGCC 1 cut(s) 228
Hin1II CATG 3 cut(s) 169, 330, 341
HincII GTYRAC 1 cut(s) 316
HindII GTYRAC 1 cut(s) 316
HphI GGTGA 1 cut(s) 260
Hpy166II GTNNAC 1 cut(s) 316
Hpy188I TCNGA 1 cut(s) 12
Hpy188III TCNNGA 3 cut(s) 28, 218, 285
Hpy8I GTNNAC 1 cut(s) 316
HpyAV CCTTC 2 cut(s) 90, 220
HpyCH4III ACNGT 1 cut(s) 291
HpyCH4V TGCA 3 cut(s) 120, 132, 343
HpyF10VI GCNNNNNNNGC 1 cut(s) 234
HpyF3I CTNAG 1 cut(s) 239
Hsp92II CATG 3 cut(s) 169, 330, 341
Kzo9I GATC 5 cut(s) 7, 214, 220, 274, 295
LmnI GCTCC 1 cut(s) 355
LpnPI CCDG 9 cut(s) 41, 70, 82, 147, 198, 210, 232, 237, 259
Lsp1109I GCAGC 1 cut(s) 355
MaeI CTAG 5 cut(s) 45, 123, 234, 272, 285
MaeIII GTNAC 1 cut(s) 389
MalI GATC 5 cut(s) 9, 216, 222, 276, 297
MboI GATC 5 cut(s) 7, 214, 220, 274, 295
MboII GAAGA 2 cut(s) 96, 269
MflI RGATCY 1 cut(s) 274
MhlI GDGCHC 1 cut(s) 337
MluCI AATT 1 cut(s) 68
MmeI TCCRAC 1 cut(s) 273
MnlI CCTC 6 cut(s) 94, 97, 100, 304, 312, 357
MspA1I CMGCKG 1 cut(s) 188
MspR9I CCNGG 2 cut(s) 225, 247
MvaI CCWGG 2 cut(s) 225, 247
MwoI GCNNNNNNNGC 1 cut(s) 234
NdeII GATC 5 cut(s) 7, 214, 220, 274, 295
NlaIII CATG 3 cut(s) 169, 330, 341
NlaIV GGNNCC 1 cut(s) 52
NspI RCATGY 2 cut(s) 169, 330
PaeI GCATGC 1 cut(s) 169
PciI ACATGT 1 cut(s) 326
PcsI WCGNNNNNNNCGW 1 cut(s) 295
PkrI GCNGC 2 cut(s) 50, 345
PscI ACATGT 1 cut(s) 326
Psp6I CCWGG 2 cut(s) 223, 245
PspGI CCWGG 2 cut(s) 223, 245
PspN4I GGNNCC 1 cut(s) 52
PsuI RGATCY 1 cut(s) 274
SatI GCNGC 2 cut(s) 49, 344
Sau3AI GATC 5 cut(s) 7, 214, 220, 274, 295
ScrFI CCNGG 2 cut(s) 225, 247
SduI GDGCHC 1 cut(s) 337
SetI ASST 4 cut(s) 251, 273, 304, 315
SphI GCATGC 1 cut(s) 169
Sse9I AATT 1 cut(s) 68
SsiI CCGC 4 cut(s) 48, 54, 188, 207
SspMI CTAG 5 cut(s) 45, 123, 234, 272, 285
StyD4I CCNGG 2 cut(s) 223, 245
TaaI ACNGT 1 cut(s) 291
TaqI TCGA 3 cut(s) 137, 213, 298
TasI AATT 1 cut(s) 68
TauI GCSGC 1 cut(s) 51
TscAI CASTG 1 cut(s) 325
TseI GCWGC 1 cut(s) 343
TspDTI ATGAA 4 cut(s) 267, 269, 360, 374
TspRI CASTG 1 cut(s) 325
XbaI TCTAGA 1 cut(s) 284
XceI RCATGY 2 cut(s) 169, 330
XspI CTAG 5 cut(s) 45, 123, 234, 272, 285
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.