Rmu_sc0011408.1_g000007

Wall-associated receptor kinase

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0011408.1
Physical Location & Seq
Forward (+)
26667 .. 27017
351 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0011408.1_g000007.1.cds

Sequence Viewer

Length: 351 bp
atggaggagccatggaatcaacaaaaatctttacaacgtaagaacttgagaaggccacaaacaattaccatgcagatgagatccttggtgaaggaggctatggaatggtttacaaaggaattctgccctgaatactttcagttcaatcaactcaccgaaaaaagtgatgtcagtagctttggagttgtcctcgcaatactaacgagcagagtggcactttcttttgctagacctgacgcagagagttgcccagcaaatttttttgtttcttcaatagagaaagattgctttattgaaattcttgatgctgacatagtgaatgagaagaacatagagacaactctttgctga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.

Protein Analysis

116

Amino Acids

13.48

Weight (kDa)

4.87

Isoelectric Point (pI)

64.56

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0024063)

Species Orthologous Gene IDs
fragaria_vesca FvH4_3g10500
rosa_laevigata RLG00000023085
rosa_multiflora Rmu_sc0011408.1_g000007

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 75
AcsI RAATTY 3 cut(s) 119, 256, 297
AgsI TTSAA 3 cut(s) 145, 273, 296
AluBI AGCT 1 cut(s) 177
AluI AGCT 1 cut(s) 177
Alw26I GTCTC 1 cut(s) 329
AlwI GGATC 1 cut(s) 75
AoxI GGCC 1 cut(s) 53
ApoI RAATTY 3 cut(s) 119, 256, 297
Asp700I GAANNNNTTC 1 cut(s) 135
AsuHPI GGTGA 2 cut(s) 100, 145
BcoDI GTCTC 1 cut(s) 329
BfaI CTAG 1 cut(s) 228
BmiI GGNNCC 1 cut(s) 9
BmsI GCATC 1 cut(s) 295
BplI GAGNNNNNCTC 2 cut(s) 174, 206
BpuEI CTTGAG 1 cut(s) 67
BsaJI CCNNGG 2 cut(s) 11, 84
BseDI CCNNGG 2 cut(s) 11, 84
BseRI GAGGAG 1 cut(s) 20
BseYI CCCAGC 1 cut(s) 250
BshFI GGCC 1 cut(s) 55
BsmAI GTCTC 1 cut(s) 329
BsnI GGCC 1 cut(s) 55
Bsp143I GATC 1 cut(s) 80
Bsp19I CCATGG 1 cut(s) 11
BspANI GGCC 1 cut(s) 55
BspLI GGNNCC 1 cut(s) 9
BspPI GGATC 1 cut(s) 75
BssECI CCNNGG 2 cut(s) 11, 84
BssMI GATC 1 cut(s) 80
BssT1I CCWWGG 2 cut(s) 11, 84
BstDSI CCRYGG 1 cut(s) 11
BstKTI GATC 1 cut(s) 83
BstMAI GTCTC 1 cut(s) 329
BstMBI GATC 1 cut(s) 80
BstX2I RGATCY 1 cut(s) 80
BstYI RGATCY 1 cut(s) 80
BsuRI GGCC 1 cut(s) 55
BtgI CCRYGG 1 cut(s) 11
CseI GACGC 1 cut(s) 245
CviAII CATG 2 cut(s) 12, 70
CviJI RGCY 4 cut(s) 10, 55, 98, 177
CviKI_1 RGCY 4 cut(s) 10, 55, 98, 177
DpnI GATC 1 cut(s) 82
DpnII GATC 1 cut(s) 80
Eco130I CCWWGG 2 cut(s) 11, 84
EcoRI GAATTC 1 cut(s) 119
EcoT14I CCWWGG 2 cut(s) 11, 84
ErhI CCWWGG 2 cut(s) 11, 84
FaeI CATG 2 cut(s) 15, 73
FaiI YATR 5 cut(s) 13, 71, 101, 314, 332
FatI CATG 2 cut(s) 11, 69
FspBI CTAG 1 cut(s) 228
GsaI CCCAGC 1 cut(s) 254
HaeIII GGCC 1 cut(s) 55
HgaI GACGC 1 cut(s) 245
Hin1II CATG 2 cut(s) 15, 73
HinfI GANTC 1 cut(s) 16
HphI GGTGA 2 cut(s) 100, 145
Hpy166II GTNNAC 1 cut(s) 111
Hpy188III TCNNGA 1 cut(s) 302
Hpy8I GTNNAC 1 cut(s) 111
HpyAV CCTTC 2 cut(s) 45, 85
HpyCH4IV ACGT 1 cut(s) 37
HpyCH4V TGCA 1 cut(s) 73
HpySE526I ACGT 1 cut(s) 37
Hsp92II CATG 2 cut(s) 15, 73
Kzo9I GATC 1 cut(s) 80
LmnI GCTCC 1 cut(s) 7
LpnPI CCDG 3 cut(s) 141, 246, 264
LweI GCATC 1 cut(s) 295
MaeI CTAG 1 cut(s) 228
MaeII ACGT 1 cut(s) 37
MalI GATC 1 cut(s) 82
MboI GATC 1 cut(s) 80
MboII GAAGA 2 cut(s) 261, 337
MflI RGATCY 1 cut(s) 80
MluCI AATT 4 cut(s) 63, 119, 256, 297
MnlI CCTC 2 cut(s) 88, 200
MroXI GAANNNNTTC 1 cut(s) 135
MslI CAYNNNNRTG 1 cut(s) 74
NcoI CCATGG 1 cut(s) 11
NdeII GATC 1 cut(s) 80
NlaIII CATG 2 cut(s) 15, 73
NlaIV GGNNCC 1 cut(s) 9
PdmI GAANNNNTTC 1 cut(s) 135
PfeI GAWTC 1 cut(s) 16
PspFI CCCAGC 1 cut(s) 250
PspN4I GGNNCC 1 cut(s) 9
PsuI RGATCY 1 cut(s) 80
RseI CAYNNNNRTG 1 cut(s) 74
Sau3AI GATC 1 cut(s) 80
SetI ASST 3 cut(s) 40, 179, 235
SfaNI GCATC 1 cut(s) 295
SmiMI CAYNNNNRTG 1 cut(s) 74
SmlI CTYRAG 1 cut(s) 46
SmoI CTYRAG 1 cut(s) 46
Sse9I AATT 4 cut(s) 63, 119, 256, 297
SspMI CTAG 1 cut(s) 228
StyI CCWWGG 2 cut(s) 11, 84
TaiI ACGT 1 cut(s) 40
TasI AATT 4 cut(s) 63, 119, 256, 297
TfiI GAWTC 1 cut(s) 16
XapI RAATTY 3 cut(s) 119, 256, 297
XmnI GAANNNNTTC 1 cut(s) 135
XspI CTAG 1 cut(s) 228
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.