Rmu_sc0012235.1_g000004

Cytochrome b5-like Heme/Steroid binding domain

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0012235.1
OG0016766
Physical Location & Seq
Forward (+)
11281 .. 12633
1353 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0012235.1_g000004.1.cds

Sequence Viewer

Length: 1353 bp
atggcagagctcaacaacaagaagtatatttcctctcaagacctagcaaaacacaacaagccaggagatctatggatctcaatacagggaaaagtctacaacgtctccgactgggcccaatcccaccccggcggcgagctcccattgctgaacctcgctggccaagacgtcaccgacgccttcgtcgcctaccaccccggctcggcgtggcaacatcttgaccggttcttcaatggctactatctccaacactacacagtctccgaggtgtccaaggattacaggaaactcgtcaacgagttttcgaagatgggtttgttcgaaaacaggggacttggtgtttatttccagcttttttctgtggcaatgttgttcagtttgagtgtctatggtgttttgtgttctgataaggcatgggttcatttggtctcgggtgggttaatgggcttgggttggattcagagtgggtggcttggtcatgattccgggcattaccagatcatcagcaacaaaaacgtgaacagattcgctcagatcctcactggaaactgccttgctggcatcagcattgcttggtggaagaggaaccacaatgcccaccacattgcttgtaacagccttgaattcgatccagatcttcagcacatgcctttctttgcggtatcttcgaaactgttccagtcccttaggtcttgttattatgataggaagatgaatttcgataagtttactaggttcttggttagctatcagcactggacattttaccctgtgatgtgttttgctaggattaatctttttgctcagtcattcatgttgttagggtctaagaggttgagggtgcccaataggggccaggagattttggggcttcttgtgttttggatttggtttcctctgctagtttcgtgcttgcccaattggggtgagagagtcttgtttgttgttgctagcttttcgatcactgggattcagcatgttcagttctgcttgaaccatttctcttcaagtgtctatgttggtactcctgttgggaatgactggtgtgagaagcagactaatgggtcacttgatatagtgtgcccatcttggatggattggtttcatggtggtttgcagtttcaaatcgagcatcatttgtttccgaggttgcctagaaggtatctgaggaagattgctcctcttgttaaggagctttgcaagaagcacaatctaccttacacaagcgtgtcattcacaaaggccaacacattgacagttgggactctgcgtgctgcagccttgcaggctcgtgatcttaccagccctgttccaaagaatttagtttgggaagctgtacacacatatggataa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Cyt-b5 FA_desaturase

Protein Analysis

450

Amino Acids

51.52

Weight (kDa)

9.16

Isoelectric Point (pI)

43.16

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0016766)

Species Orthologous Gene IDs
fragaria_vesca FvH4_2g31760
malus_domestica MD08G1063400.v1.1
prunus_persica Prupe.1G411100_v2.0.a1
pyrus_communis pycom08g05210 pycom15g05510
rosa_chinensis RchiOBHm_Chr6g0311061
rosa_laevigata RLG00000010439
rosa_multiflora Rmu_sc0012235.1_g000004
rosa_roxburghii Rroxscaffold_7G00158060
rosa_rugosa Rorug06G0385000
rosa_samantha Rh6AG499000 Rh6BG509600 Rh6CG515400
rosa_wichuraiana Rw6G043460

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AasI GACNNNNNNGTC 2 cut(s) 182, 1063
AatII GACGTC 1 cut(s) 171
AccB1I GGYRCC 1 cut(s) 841
AccI GTMKAC 1 cut(s) 96
AciI CCGC 2 cut(s) 132, 659
AclWI GGATC 3 cut(s) 83, 529, 623
AcoI YGGCCR 1 cut(s) 160
AcsI RAATTY 3 cut(s) 623, 715, 1318
AcuI CTGAAG 1 cut(s) 623
AcyI GRCGYC 2 cut(s) 168, 177
AfaI GTAC 2 cut(s) 1024, 1338
AfiI CCNNNNNNNGG 3 cut(s) 202, 851, 923
AgeI ACCGGT 1 cut(s) 222
AgsI TTSAA 5 cut(s) 232, 623, 994, 1008, 1124
AjnI CCWGG 2 cut(s) 61, 855
AleI CACNNNNGTG 1 cut(s) 1226
AluBI AGCT 7 cut(s) 10, 139, 352, 747, 954, 1195, 1334
AluI AGCT 7 cut(s) 10, 139, 352, 747, 954, 1195, 1334
Alw21I GWGCWC 2 cut(s) 12, 141
Alw26I GTCTC 3 cut(s) 109, 265, 433
AlwI GGATC 3 cut(s) 83, 529, 623
Ama87I CYCGRG 1 cut(s) 430
AoxI GGCC 4 cut(s) 114, 160, 853, 1242
ApaI GGGCCC 1 cut(s) 118
ApeKI GCWGC 2 cut(s) 1274, 1277
ApoI RAATTY 3 cut(s) 623, 715, 1318
AseI ATTAAT 1 cut(s) 792
AsiGI ACCGGT 1 cut(s) 222
Asp700I GAANNNNTTC 3 cut(s) 524, 674, 998
AspS9I GGNCC 3 cut(s) 114, 115, 853
AsuC2I CCSGG 3 cut(s) 129, 198, 487
AsuHPI GGTGA 2 cut(s) 163, 938
AsuII TTCGAA 3 cut(s) 305, 321, 668
AsuNHI GCTAGC 1 cut(s) 950
AvaI CYCGRG 1 cut(s) 430
AxyI CCTNAGG 1 cut(s) 686
BaeGI GKGCMC 3 cut(s) 118, 846, 1085
BaeI ACNNNNGTAYC 2 cut(s) 1014, 1047
BalI TGGCCA 1 cut(s) 162
BanI GGYRCC 1 cut(s) 841
BanII GRGCYC 3 cut(s) 12, 118, 141
BauI CACGAG 1 cut(s) 1290
Bbv12I GWGCWC 2 cut(s) 12, 141
BbvI GCAGC 2 cut(s) 1261, 1289
BccI CCATC 3 cut(s) 304, 1087, 1093
BciT130I CCWGG 2 cut(s) 63, 857
BcnI CCSGG 3 cut(s) 129, 198, 487
BcoDI GTCTC 3 cut(s) 109, 265, 433
BfaI CTAG 6 cut(s) 44, 732, 786, 902, 951, 1155
BfmI CTRYAG 1 cut(s) 1275
BglI GCCNNNNNGGC 2 cut(s) 558, 1286
BglII AGATCT 2 cut(s) 67, 634
BisI GCNGC 3 cut(s) 133, 1275, 1278
BlsI GCNGC 3 cut(s) 134, 1276, 1279
Bme1390I CCNGG 5 cut(s) 63, 129, 198, 487, 857
BmeT110I CYCGRG 1 cut(s) 430
BmgT120I GGNCC 3 cut(s) 114, 115, 853
BmiI GGNNCC 4 cut(s) 116, 587, 843, 854
BmrFI CCNGG 5 cut(s) 63, 129, 198, 487, 857
BmrI ACTGGG 2 cut(s) 121, 975
BmsI GCATC 2 cut(s) 570, 1141
BmtI GCTAGC 1 cut(s) 954
BmuI ACTGGG 2 cut(s) 121, 975
Bpu14I TTCGAA 3 cut(s) 305, 321, 668
BpuEI CTTGAG 1 cut(s) 21
BpuMI CCSGG 3 cut(s) 129, 198, 487
BsaBI GATNNNNATC 1 cut(s) 633
BsaHI GRCGYC 2 cut(s) 168, 177
BsaI GGTCTC 1 cut(s) 433
BsaJI CCNNGG 5 cut(s) 127, 196, 264, 273, 1145
BsaWI WCCGGW 1 cut(s) 222
BsaXI ACNNNNNCTCC 4 cut(s) 89, 119, 245, 275
Bsc4I CCNNNNNNNGG 3 cut(s) 202, 851, 923
Bse118I RCCGGY 1 cut(s) 222
Bse1I ACTGG 6 cut(s) 116, 547, 679, 761, 970, 1046
Bse21I CCTNAGG 1 cut(s) 686
Bse3DI GCAATG 4 cut(s) 143, 372, 567, 603
Bse8I GATNNNNATC 1 cut(s) 633
BseBI CCWGG 2 cut(s) 63, 857
BseDI CCNNGG 5 cut(s) 127, 196, 264, 273, 1145
BseGI GGATG 1 cut(s) 1098
BseJI GATNNNNATC 1 cut(s) 633
BseLI CCNNNNNNNGG 3 cut(s) 202, 851, 923
BseMI GCAATG 4 cut(s) 143, 372, 567, 603
BseMII CTCAG 3 cut(s) 545, 818, 1157
BseNI ACTGG 6 cut(s) 116, 547, 679, 761, 970, 1046
BseRI GAGGAG 1 cut(s) 1170
BseSI GKGCMC 3 cut(s) 118, 846, 1085
BseXI GCAGC 2 cut(s) 1261, 1289
BshFI GGCC 4 cut(s) 116, 162, 855, 1244
BshNI GGYRCC 1 cut(s) 841
BshTI ACCGGT 1 cut(s) 222
BsiHKAI GWGCWC 2 cut(s) 12, 141
BsiHKCI CYCGRG 1 cut(s) 430
BsiSI CCGG 4 cut(s) 129, 198, 223, 486
BslFI GGGAC 3 cut(s) 345, 667, 1276
BslI CCNNNNNNNGG 3 cut(s) 202, 851, 923
BsmAI GTCTC 3 cut(s) 109, 265, 433
BsmBI CGTCTC 1 cut(s) 109
BsmFI GGGAC 3 cut(s) 345, 667, 1276
BsnI GGCC 4 cut(s) 116, 162, 855, 1244
Bso31I GGTCTC 1 cut(s) 433
BsoBI CYCGRG 1 cut(s) 430
Bsp119I TTCGAA 3 cut(s) 305, 321, 668
Bsp120I GGGCCC 1 cut(s) 114
Bsp1286I GDGCHC 5 cut(s) 12, 118, 141, 846, 1085
Bsp1407I TGTACA 1 cut(s) 1336
Bsp143I GATC 8 cut(s) 67, 75, 498, 534, 628, 634, 960, 1294
BspACI CCGC 2 cut(s) 132, 659
BspANI GGCC 4 cut(s) 116, 162, 855, 1244
BspCNI CTCAG 3 cut(s) 544, 817, 1158
BspHI TCATGA 1 cut(s) 478
BspLI GGNNCC 4 cut(s) 116, 587, 843, 854
BspMAI CTGCAG 1 cut(s) 1279
BspOI GCTAGC 1 cut(s) 954
BspPI GGATC 3 cut(s) 83, 529, 623
BspT104I TTCGAA 3 cut(s) 305, 321, 668
BspT107I GGYRCC 1 cut(s) 841
BspTNI GGTCTC 1 cut(s) 433
BsrDI GCAATG 4 cut(s) 143, 372, 567, 603
BsrFI RCCGGY 1 cut(s) 222
BsrGI TGTACA 1 cut(s) 1336
BsrI ACTGG 6 cut(s) 116, 547, 679, 761, 970, 1046
BssAI RCCGGY 1 cut(s) 222
BssECI CCNNGG 5 cut(s) 127, 196, 264, 273, 1145
BssMI GATC 8 cut(s) 67, 75, 498, 534, 628, 634, 960, 1294
BssNI GRCGYC 2 cut(s) 168, 177
BssSI CACGAG 1 cut(s) 1290
BssT1I CCWWGG 1 cut(s) 273
Bst2BI CACGAG 1 cut(s) 1290
Bst2UI CCWGG 2 cut(s) 63, 857
Bst4CI ACNGT 3 cut(s) 259, 675, 1258
Bst6I CTCTTC 2 cut(s) 575, 1009
BstACI GRCGYC 2 cut(s) 168, 177
BstAUI TGTACA 1 cut(s) 1336
BstBI TTCGAA 3 cut(s) 305, 321, 668
BstC8I GCNNGC 7 cut(s) 137, 160, 559, 914, 952, 1272, 1287
BstDEI CTNAG 5 cut(s) 531, 686, 804, 828, 1166
BstF5I GGATG 1 cut(s) 1098
BstKTI GATC 8 cut(s) 70, 78, 501, 537, 631, 637, 963, 1297
BstMAI GTCTC 3 cut(s) 109, 265, 433
BstMBI GATC 8 cut(s) 67, 75, 498, 534, 628, 634, 960, 1294
BstMWI GCNNNNNNNGC 4 cut(s) 145, 185, 558, 1286
BstNI CCWGG 2 cut(s) 63, 857
BstNSI RCATGY 2 cut(s) 649, 980
BstSCI CCNGG 5 cut(s) 61, 127, 196, 485, 855
BstSFI CTRYAG 1 cut(s) 1275
BstSLI GKGCMC 3 cut(s) 118, 846, 1085
BstV1I GCAGC 2 cut(s) 1261, 1289
BstX2I RGATCY 4 cut(s) 67, 75, 534, 634
BstYI RGATCY 4 cut(s) 67, 75, 534, 634
Bsu36I CCTNAGG 1 cut(s) 686
BsuRI GGCC 4 cut(s) 116, 162, 855, 1244
BtsCI GGATG 1 cut(s) 1098
BtsIMutI CAGTG 3 cut(s) 540, 754, 963
Cac8I GCNNGC 7 cut(s) 137, 160, 559, 914, 952, 1272, 1287
CciI TCATGA 1 cut(s) 478
Cfr10I RCCGGY 1 cut(s) 222
Cfr13I GGNCC 3 cut(s) 114, 115, 853
CseI GACGC 1 cut(s) 185
Csp6I GTAC 2 cut(s) 1023, 1337
CspAI ACCGGT 1 cut(s) 222
CspCI CAANNNNNGTGG 2 cut(s) 590, 625
CviAII CATG 6 cut(s) 414, 479, 646, 814, 977, 1106
CviQI GTAC 2 cut(s) 1023, 1337
DdeI CTNAG 5 cut(s) 531, 686, 804, 828, 1166
DpnI GATC 8 cut(s) 69, 77, 500, 536, 630, 636, 962, 1296
DpnII GATC 8 cut(s) 67, 75, 498, 534, 628, 634, 960, 1294
DrdI GACNNNNNNGTC 2 cut(s) 182, 1063
DseDI GACNNNNNNGTC 2 cut(s) 182, 1063
EaeI YGGCCR 1 cut(s) 160
Eam1104I CTCTTC 2 cut(s) 575, 1009
EarI CTCTTC 2 cut(s) 575, 1009
Ecl136II GAGCTC 2 cut(s) 10, 139
Eco130I CCWWGG 1 cut(s) 273
Eco24I GRGCYC 3 cut(s) 12, 118, 141
Eco31I GGTCTC 1 cut(s) 433
Eco53kI GAGCTC 2 cut(s) 10, 139
Eco57I CTGAAG 1 cut(s) 623
Eco81I CCTNAGG 1 cut(s) 686
Eco88I CYCGRG 1 cut(s) 430
EcoICRI GAGCTC 2 cut(s) 10, 139
EcoRI GAATTC 1 cut(s) 623
EcoRII CCWGG 2 cut(s) 61, 855
EcoT14I CCWWGG 1 cut(s) 273
EcoT38I GRGCYC 3 cut(s) 12, 118, 141
ErhI CCWWGG 1 cut(s) 273
Esp3I CGTCTC 1 cut(s) 109
FaeI CATG 6 cut(s) 417, 482, 649, 817, 980, 1109
FaqI GGGAC 3 cut(s) 345, 667, 1276
FatI CATG 6 cut(s) 413, 478, 645, 813, 976, 1105
FauNDI CATATG 1 cut(s) 1345
FblI GTMKAC 1 cut(s) 96
Fnu4HI GCNGC 3 cut(s) 133, 1275, 1278
FokI GGATG 1 cut(s) 1105
FriOI GRGCYC 3 cut(s) 12, 118, 141
Fsp4HI GCNGC 3 cut(s) 133, 1275, 1278
FspBI CTAG 6 cut(s) 44, 732, 786, 902, 951, 1155
GluI GCNGC 3 cut(s) 133, 1275, 1278
HaeIII GGCC 4 cut(s) 116, 162, 855, 1244
HapII CCGG 4 cut(s) 129, 198, 223, 486
HgaI GACGC 1 cut(s) 185
Hin1I GRCGYC 2 cut(s) 168, 177
Hin1II CATG 6 cut(s) 417, 482, 649, 817, 980, 1109
HincII GTYRAC 1 cut(s) 295
HindII GTYRAC 1 cut(s) 295
HinfI GANTC 6 cut(s) 457, 482, 525, 933, 970, 1264
HpaII CCGG 4 cut(s) 129, 198, 223, 486
HphI GGTGA 2 cut(s) 163, 938
Hpy166II GTNNAC 5 cut(s) 97, 295, 520, 729, 1339
Hpy188I TCNGA 7 cut(s) 109, 265, 406, 462, 534, 1146, 1167
Hpy188III TCNNGA 5 cut(s) 38, 218, 479, 632, 1292
Hpy8I GTNNAC 5 cut(s) 97, 295, 520, 729, 1339
Hpy99I CGWCG 2 cut(s) 179, 188
HpyAV CCTTC 2 cut(s) 190, 1152
HpyCH4III ACNGT 3 cut(s) 259, 675, 1258
HpyCH4IV ACGT 3 cut(s) 102, 168, 516
HpyCH4V TGCA 4 cut(s) 1117, 1200, 1277, 1285
HpyF10VI GCNNNNNNNGC 4 cut(s) 145, 185, 558, 1286
HpyF3I CTNAG 5 cut(s) 531, 686, 804, 828, 1166
HpySE526I ACGT 3 cut(s) 102, 168, 516
Hsp92I GRCGYC 2 cut(s) 168, 177
Hsp92II CATG 6 cut(s) 417, 482, 649, 817, 980, 1109
Kzo9I GATC 8 cut(s) 67, 75, 498, 534, 628, 634, 960, 1294
LmnI GCTCC 3 cut(s) 144, 1183, 1192
Lsp1109I GCAGC 2 cut(s) 1261, 1289
LweI GCATC 2 cut(s) 570, 1141
MaeI CTAG 6 cut(s) 44, 732, 786, 902, 951, 1155
MaeII ACGT 3 cut(s) 102, 168, 516
MaeIII GTNAC 3 cut(s) 169, 611, 1065
MalI GATC 8 cut(s) 69, 77, 500, 536, 630, 636, 962, 1296
MboI GATC 8 cut(s) 67, 75, 498, 534, 628, 634, 960, 1294
MboII GAAGA 8 cut(s) 220, 319, 592, 629, 657, 721, 996, 1183
MfeI CAATTG 1 cut(s) 919
MflI RGATCY 4 cut(s) 67, 75, 534, 634
MhlI GDGCHC 5 cut(s) 12, 118, 141, 846, 1085
MlsI TGGCCA 1 cut(s) 162
MluCI AATT 4 cut(s) 623, 715, 919, 1318
MluNI TGGCCA 1 cut(s) 162
MlyI GAGTC 2 cut(s) 942, 1258
MmeI TCCRAC 3 cut(s) 132, 271, 434
Mox20I TGGCCA 1 cut(s) 162
MroXI GAANNNNTTC 3 cut(s) 524, 674, 998
MscI TGGCCA 1 cut(s) 162
MseI TTAA 3 cut(s) 440, 792, 1188
MslI CAYNNNNRTG 2 cut(s) 1226, 1344
Msp20I TGGCCA 1 cut(s) 162
MspI CCGG 4 cut(s) 129, 198, 223, 486
MspR9I CCNGG 5 cut(s) 63, 129, 198, 487, 857
MunI CAATTG 1 cut(s) 919
MvaI CCWGG 2 cut(s) 63, 857
MwoI GCNNNNNNNGC 4 cut(s) 145, 185, 558, 1286
NciI CCSGG 3 cut(s) 129, 198, 487
NdeI CATATG 1 cut(s) 1345
NdeII GATC 8 cut(s) 67, 75, 498, 534, 628, 634, 960, 1294
NheI GCTAGC 1 cut(s) 950
NlaIII CATG 6 cut(s) 417, 482, 649, 817, 980, 1109
NlaIV GGNNCC 4 cut(s) 116, 587, 843, 854
NmeAIII GCCGAG 1 cut(s) 182
NmuCI GTSAC 2 cut(s) 169, 1065
NspI RCATGY 2 cut(s) 649, 980
NspV TTCGAA 3 cut(s) 305, 321, 668
OliI CACNNNNGTG 1 cut(s) 1226
PagI TCATGA 1 cut(s) 478
PdmI GAANNNNTTC 3 cut(s) 524, 674, 998
PfeI GAWTC 4 cut(s) 457, 482, 525, 970
PinAI ACCGGT 1 cut(s) 222
PkrI GCNGC 3 cut(s) 134, 1276, 1279
PleI GAGTC 2 cut(s) 941, 1258
PpsI GAGTC 2 cut(s) 941, 1258
PshBI ATTAAT 1 cut(s) 792
Psp124BI GAGCTC 2 cut(s) 12, 141
Psp6I CCWGG 2 cut(s) 61, 855
PspGI CCWGG 2 cut(s) 61, 855
PspN4I GGNNCC 4 cut(s) 116, 587, 843, 854
PspOMI GGGCCC 1 cut(s) 114
PspPI GGNCC 3 cut(s) 114, 115, 853
PstI CTGCAG 1 cut(s) 1279
PsuI RGATCY 4 cut(s) 67, 75, 534, 634
RsaI GTAC 2 cut(s) 1024, 1338
RsaNI GTAC 2 cut(s) 1023, 1337
RseI CAYNNNNRTG 2 cut(s) 1226, 1344
SacI GAGCTC 2 cut(s) 12, 141
SaqAI TTAA 3 cut(s) 440, 792, 1188
SatI GCNGC 3 cut(s) 133, 1275, 1278
Sau3AI GATC 8 cut(s) 67, 75, 498, 534, 628, 634, 960, 1294
Sau96I GGNCC 3 cut(s) 114, 115, 853
SchI GAGTC 2 cut(s) 942, 1258
ScrFI CCNGG 5 cut(s) 63, 129, 198, 487, 857
SduI GDGCHC 5 cut(s) 12, 118, 141, 846, 1085
SfaNI GCATC 2 cut(s) 570, 1141
SfcI CTRYAG 1 cut(s) 1275
SfuI TTCGAA 3 cut(s) 305, 321, 668
SmiMI CAYNNNNRTG 2 cut(s) 1226, 1344
SmlI CTYRAG 1 cut(s) 36
SmoI CTYRAG 1 cut(s) 36
Sse9I AATT 4 cut(s) 623, 715, 919, 1318
SsiI CCGC 2 cut(s) 132, 659
SspMI CTAG 6 cut(s) 44, 732, 786, 902, 951, 1155
SstI GAGCTC 2 cut(s) 12, 141
StyD4I CCNGG 5 cut(s) 61, 127, 196, 485, 855
StyI CCWWGG 1 cut(s) 273
TaaI ACNGT 3 cut(s) 259, 675, 1258
TaiI ACGT 3 cut(s) 105, 171, 519
TaqI TCGA 7 cut(s) 305, 321, 627, 668, 720, 959, 1128
TasI AATT 4 cut(s) 623, 715, 919, 1318
TatI WGTACW 1 cut(s) 1336
TauI GCSGC 1 cut(s) 135
TfiI GAWTC 4 cut(s) 457, 482, 525, 970
Tru1I TTAA 3 cut(s) 440, 792, 1188
Tru9I TTAA 3 cut(s) 440, 792, 1188
TscAI CASTG 3 cut(s) 547, 761, 970
TseFI GTSAC 2 cut(s) 169, 1065
TseI GCWGC 2 cut(s) 1274, 1277
Tsp45I GTSAC 2 cut(s) 169, 1065
TspDTI ATGAA 4 cut(s) 410, 728, 802, 1094
TspRI CASTG 3 cut(s) 547, 761, 970
VspI ATTAAT 1 cut(s) 792
XapI RAATTY 3 cut(s) 623, 715, 1318
XceI RCATGY 2 cut(s) 649, 980
XcmI CCANNNNNNNNNTGG 1 cut(s) 69
XmiI GTMKAC 1 cut(s) 96
XmnI GAANNNNTTC 3 cut(s) 524, 674, 998
XspI CTAG 6 cut(s) 44, 732, 786, 902, 951, 1155
ZraI GACGTC 1 cut(s) 169
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.