Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0013954.1

Orthogroup ID

OG0031138

Physical Location & Seq

Genomic Coordinates Reverse (-)

1 .. 1206

Gene Structure 1206 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0013954.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 573 bp

atgttagactatagtcgagctttggagttgtttagcttgaatgcattcaaaagaaatggacctccagaagattatctggaacttgcccaacgtgctatacactatgcccaaggccttccattggctttgatagttttaggctctcatctatttcgtagaagcaaagaggagtgggaagctacaataggtagttgtaaaggaggtcctcagacagagatacaagatgttcttagactaagttatgatgctcttggaccagatttaaaagaactatttcttgatatcgcttgcttctttaaaggtatggaggtccaccatgtgaaacaaatactagaagcttgctacgacctcagatcagtgattggtattgcacaactacaagaaaaagtcttaattagaattgagagatatgagccttggacaaatggaatagacaaaggtcgtatttggatgaatgacttgatagaagaaatgggtaaagacattgtgtatcaagagtcacccggtgagcctgggaaacgcagtagagtctggagtggagatgatgtcgaccacattctaacaaataatacg

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

ko04014 map04014

Pfam Domains

Protein Families

NB-ARC TIR

Protein Analysis

191

Amino Acids

21.85

Weight (kDa)

5.17

Isoelectric Point (pI)

58.25

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0031138)

Species	Orthologous Gene IDs
rosa_multiflora	Rmu_sc0001543.1_g000001 Rmu_sc0013954.1_g000001

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccI	GTMKAC	1 cut(s)	549
AdeI	CACNNNGTG	2 cut(s)	319, 506
AfiI	CCNNNNNNNGG	1 cut(s)	121
AgsI	TTSAA	2 cut(s)	40, 49
AjnI	CCWGG	1 cut(s)	511
AluBI	AGCT	4 cut(s)	20, 36, 179, 338
AluI	AGCT	4 cut(s)	20, 36, 179, 338
AoxI	GGCC	1 cut(s)	112
Asp700I	GAANNNNTTC	2 cut(s)	44, 273
AspS9I	GGNCC	4 cut(s)	59, 203, 254, 310
AsuC2I	CCSGG	1 cut(s)	504
AsuHPI	GGTGA	2 cut(s)	492, 518
AvaII	GGWCC	4 cut(s)	59, 203, 254, 310
BciT130I	CCWGG	1 cut(s)	513
BcnI	CCSGG	1 cut(s)	504
BfaI	CTAG	1 cut(s)	332
BfmI	CTRYAG	1 cut(s)	10
Bme1390I	CCNGG	2 cut(s)	504, 513
Bme18I	GGWCC	4 cut(s)	59, 203, 254, 310
BmgT120I	GGNCC	4 cut(s)	59, 203, 254, 310
BmrFI	CCNGG	2 cut(s)	504, 513
BmsI	GCATC	1 cut(s)	235
BoxI	GACNNNNGTC	2 cut(s)	12, 438
BpmI	CTGGAG	2 cut(s)	48, 553
BpuMI	CCSGG	1 cut(s)	504
BsaJI	CCNNGG	3 cut(s)	109, 416, 512
BsaXI	ACNNNNNCTCC	2 cut(s)	531, 561
Bsc4I	CCNNNNNNNGG	1 cut(s)	121
BseBI	CCWGG	1 cut(s)	513
BseDI	CCNNGG	3 cut(s)	109, 416, 512
BseGI	GGATG	1 cut(s)	456
BseLI	CCNNNNNNNGG	1 cut(s)	121
BseMII	CTCAG	2 cut(s)	221, 364
BseRI	GAGGAG	1 cut(s)	182
BshFI	GGCC	1 cut(s)	114
BsiSI	CCGG	1 cut(s)	504
BslI	CCNNNNNNNGG	1 cut(s)	121
BsmI	GAATGC	2 cut(s)	44, 46
BsnI	GGCC	1 cut(s)	114
Bsp143I	GATC	1 cut(s)	353
BspANI	GGCC	1 cut(s)	114
BspCNI	CTCAG	2 cut(s)	220, 363
BssECI	CCNNGG	3 cut(s)	109, 416, 512
BssMI	GATC	1 cut(s)	353
BssT1I	CCWWGG	2 cut(s)	109, 416
Bst2UI	CCWGG	1 cut(s)	513
BstC8I	GCNNGC	2 cut(s)	289, 340
BstDEI	CTNAG	4 cut(s)	207, 230, 236, 350
BstF5I	GGATG	1 cut(s)	456
BstKTI	GATC	1 cut(s)	356
BstMBI	GATC	1 cut(s)	353
BstMWI	GCNNNNNNNGC	1 cut(s)	92
BstNI	CCWGG	1 cut(s)	513
BstPAI	GACNNNNGTC	2 cut(s)	12, 438
BstSCI	CCNGG	2 cut(s)	502, 511
BstSFI	CTRYAG	1 cut(s)	10
BsuRI	GGCC	1 cut(s)	114
BtsCI	GGATG	1 cut(s)	456
BtsIMutI	CAGTG	1 cut(s)	363
Cac8I	GCNNGC	2 cut(s)	289, 340
Cfr13I	GGNCC	4 cut(s)	59, 203, 254, 310
CviAII	CATG	1 cut(s)	317
CviJI	RGCY	9 cut(s)	20, 36, 114, 125, 141, 179, 338, 415, 511
CviKI_1	RGCY	9 cut(s)	20, 36, 114, 125, 141, 179, 338, 415, 511
DdeI	CTNAG	4 cut(s)	207, 230, 236, 350
DpnI	GATC	1 cut(s)	355
DpnII	GATC	1 cut(s)	353
DraI	TTTAAA	2 cut(s)	264, 298
DraIII	CACNNNGTG	2 cut(s)	319, 506
Eco130I	CCWWGG	2 cut(s)	109, 416
Eco147I	AGGCCT	1 cut(s)	114
Eco32I	GATATC	1 cut(s)	283
Eco47I	GGWCC	4 cut(s)	59, 203, 254, 310
EcoO109I	RGGNCCY	1 cut(s)	203
EcoRII	CCWGG	1 cut(s)	511
EcoRV	GATATC	1 cut(s)	283
EcoT14I	CCWWGG	2 cut(s)	109, 416
EcoT22I	ATGCAT	1 cut(s)	46
ErhI	CCWWGG	2 cut(s)	109, 416
FaeI	CATG	1 cut(s)	320
FaiI	YATR	7 cut(s)	12, 98, 105, 243, 305, 318, 411
FalI	AAGNNNNNCTT	2 cut(s)	213, 245
FatI	CATG	1 cut(s)	316
FblI	GTMKAC	1 cut(s)	549
FokI	GGATG	1 cut(s)	463
FspBI	CTAG	1 cut(s)	332
GsuI	CTGGAG	2 cut(s)	48, 553
HaeIII	GGCC	1 cut(s)	114
HapII	CCGG	1 cut(s)	504
Hin1II	CATG	1 cut(s)	320
HincII	GTYRAC	1 cut(s)	550
HindII	GTYRAC	1 cut(s)	550
HindIII	AAGCTT	1 cut(s)	336
HinfI	GANTC	2 cut(s)	497, 528
HpaII	CCGG	1 cut(s)	504
HphI	GGTGA	2 cut(s)	492, 518
Hpy166II	GTNNAC	2 cut(s)	313, 550
Hpy188I	TCNGA	2 cut(s)	210, 353
Hpy188III	TCNNGA	5 cut(s)	65, 77, 278, 494, 532
Hpy8I	GTNNAC	2 cut(s)	313, 550
HpyAV	CCTTC	1 cut(s)	125
HpyCH4IV	ACGT	1 cut(s)	91
HpyCH4V	TGCA	2 cut(s)	44, 371
HpyF10VI	GCNNNNNNNGC	1 cut(s)	92
HpyF3I	CTNAG	4 cut(s)	207, 230, 236, 350
HpySE526I	ACGT	1 cut(s)	91
Hsp92II	CATG	1 cut(s)	320
Kzo9I	GATC	1 cut(s)	353
LpnPI	CCDG	7 cut(s)	62, 78, 270, 498, 517, 517, 525
LweI	GCATC	1 cut(s)	235
MaeI	CTAG	1 cut(s)	332
MaeII	ACGT	1 cut(s)	91
MaeIII	GTNAC	1 cut(s)	498
MalI	GATC	1 cut(s)	355
MboI	GATC	1 cut(s)	353
MboII	GAAGA	2 cut(s)	80, 479
MluCI	AATT	2 cut(s)	393, 399
MlyI	GAGTC	2 cut(s)	506, 537
MnlI	CCTC	6 cut(s)	72, 160, 194, 216, 301, 359
Mph1103I	ATGCAT	1 cut(s)	46
MroXI	GAANNNNTTC	2 cut(s)	44, 273
MseI	TTAA	3 cut(s)	263, 297, 392
MspI	CCGG	1 cut(s)	504
MspR9I	CCNGG	2 cut(s)	504, 513
Mva1269I	GAATGC	2 cut(s)	44, 46
MvaI	CCWGG	1 cut(s)	513
MwoI	GCNNNNNNNGC	1 cut(s)	92
NciI	CCSGG	1 cut(s)	504
NdeII	GATC	1 cut(s)	353
NlaIII	CATG	1 cut(s)	320
NmuCI	GTSAC	1 cut(s)	498
NsiI	ATGCAT	1 cut(s)	46
PceI	AGGCCT	1 cut(s)	114
PctI	GAATGC	2 cut(s)	44, 46
PdmI	GAANNNNTTC	2 cut(s)	44, 273
PleI	GAGTC	2 cut(s)	505, 536
PpsI	GAGTC	2 cut(s)	505, 536
PpuMI	RGGWCCY	1 cut(s)	203
PshAI	GACNNNNGTC	2 cut(s)	12, 438
Psp5II	RGGWCCY	1 cut(s)	203
Psp6I	CCWGG	1 cut(s)	511
PspGI	CCWGG	1 cut(s)	511
PspPI	GGNCC	4 cut(s)	59, 203, 254, 310
PspPPI	RGGWCCY	1 cut(s)	203
SalI	GTCGAC	1 cut(s)	548
SaqAI	TTAA	3 cut(s)	263, 297, 392
Sau3AI	GATC	1 cut(s)	353
Sau96I	GGNCC	4 cut(s)	59, 203, 254, 310
SchI	GAGTC	2 cut(s)	506, 537
ScrFI	CCNGG	2 cut(s)	504, 513
SfaNI	GCATC	1 cut(s)	235
SfcI	CTRYAG	1 cut(s)	10
SinI	GGWCC	4 cut(s)	59, 203, 254, 310
Sse9I	AATT	2 cut(s)	393, 399
SseBI	AGGCCT	1 cut(s)	114
SspMI	CTAG	1 cut(s)	332
StuI	AGGCCT	1 cut(s)	114
StyD4I	CCNGG	2 cut(s)	502, 511
StyI	CCWWGG	2 cut(s)	109, 416
TaiI	ACGT	1 cut(s)	94
TaqI	TCGA	2 cut(s)	16, 549
TasI	AATT	2 cut(s)	393, 399
Tru1I	TTAA	3 cut(s)	263, 297, 392
Tru9I	TTAA	3 cut(s)	263, 297, 392
TscAI	CASTG	1 cut(s)	363
TseFI	GTSAC	1 cut(s)	498
Tsp45I	GTSAC	1 cut(s)	498
TspDTI	ATGAA	1 cut(s)	467
TspRI	CASTG	1 cut(s)	363
VpaK11BI	GGWCC	4 cut(s)	59, 203, 254, 310
XmiI	GTMKAC	1 cut(s)	549
XmnI	GAANNNNTTC	2 cut(s)	44, 273
XspI	CTAG	1 cut(s)	332
Zsp2I	ATGCAT	1 cut(s)	46

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.