Rmu_sc0016098.1_g000001

SCY1-like protein

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0016098.1
Physical Location & Seq
Forward (+)
461 .. 3965
3505 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0016098.1_g000001.1.cds

Sequence Viewer

Length: 798 bp
atgggtttgttggaagtgaagcatggtttgctccagatagctgagtccttggactttctccataacaatgcgcatcttattcatcgagctatatcacccgagaatgtgtttattacatcaagtggagcttggaagcttggtggatttggttttgcaatctcaacagatcaggcctcaggcaatatgaatgttccggaatttcattatgcagagtatgatgttgaggactctgtacttccacttcagccatcactgaattacactgctcctgaacttgctaggagtaaagcatcttcagccggatgttcttctgatattttcagctttggatgtcttgcctaccacttgattgcacacaaacctttgtttgactgccacaataatgtcaagatgtacatgaataccttaagttatttatctagtgaagccttctcctctattcctcctgagttagttcctgacttgcaaaggatgatctctacaaatgagtctttcaggccatcagcaattgattttacaggttctccatttttccgggatgacactaggttgcgtgctcttcgttttctcgaccacatgctcgaaagggataacatgcagaaatctgagttcctaaaagcattgtctgatatgtggaaagattttgatgctcgtgtattgcgctataaggtactgcctcctctttgtgcagaactgaggaatttggtaatgcaaccgatgattctgcctatggttctcatgattgctgagtctcaggtactagttacttcacctttgcacatggaaatcaacagctag

Protein Analysis

265

Amino Acids

29.85

Weight (kDa)

5.53

Isoelectric Point (pI)

53.05

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0031195)

Species Orthologous Gene IDs
rosa_multiflora Rmu_sc0002219.1_g000012 Rmu_sc0016098.1_g000001

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc16I TGCGCA 1 cut(s) 72
AccIII TCCGGA 1 cut(s) 193
AcsI RAATTY 2 cut(s) 197, 700
AcuI CTGAAG 2 cut(s) 227, 279
AfaI GTAC 4 cut(s) 234, 395, 672, 759
AflII CTTAAG 1 cut(s) 406
AhlI ACTAGT 1 cut(s) 760
AluBI AGCT 6 cut(s) 41, 89, 128, 136, 324, 795
AluI AGCT 6 cut(s) 41, 89, 128, 136, 324, 795
Alw21I GWGCWC 1 cut(s) 559
Alw26I GTCTC 1 cut(s) 756
Ama87I CYCGRG 1 cut(s) 98
Aor13HI TCCGGA 1 cut(s) 193
AoxI GGCC 2 cut(s) 171, 497
ApoI RAATTY 2 cut(s) 197, 700
AspLEI GCGC 2 cut(s) 73, 663
AsuC2I CCSGG 1 cut(s) 536
AsuHPI GGTGA 2 cut(s) 87, 762
AvaI CYCGRG 1 cut(s) 98
AxyI CCTNAGG 1 cut(s) 175
BarI GAAGNNNNNNTAC 4 cut(s) 225, 257, 277, 309
BauI CACGAG 1 cut(s) 651
Bbv12I GWGCWC 1 cut(s) 559
BccI CCATC 2 cut(s) 256, 508
BcgI CGANNNNNNTGC 2 cut(s) 706, 740
BcnI CCSGG 1 cut(s) 536
BcoDI GTCTC 1 cut(s) 756
BcuI ACTAGT 1 cut(s) 760
BfaI CTAG 5 cut(s) 279, 420, 546, 761, 796
BfrI CTTAAG 1 cut(s) 406
Bme1390I CCNGG 1 cut(s) 536
BmeT110I CYCGRG 1 cut(s) 98
BmrFI CCNGG 1 cut(s) 536
BmsI GCATC 3 cut(s) 82, 299, 637
BpmI CTGGAG 1 cut(s) 17
BpuMI CCSGG 1 cut(s) 536
BsaJI CCNNGG 1 cut(s) 48
BsaWI WCCGGW 1 cut(s) 193
BsaXI ACNNNNNCTCC 2 cut(s) 508, 538
Bse21I CCTNAGG 1 cut(s) 175
BseAI TCCGGA 1 cut(s) 193
BseDI CCNNGG 1 cut(s) 48
BseGI GGATG 4 cut(s) 308, 335, 477, 544
BseMII CTCAG 7 cut(s) 33, 189, 438, 597, 686, 738, 767
BseRI GAGGAG 2 cut(s) 424, 669
BsgI GTGCAG 1 cut(s) 708
BshFI GGCC 2 cut(s) 173, 499
BsiHKAI GWGCWC 1 cut(s) 559
BsiHKCI CYCGRG 1 cut(s) 98
BsiSI CCGG 3 cut(s) 194, 300, 535
BsmAI GTCTC 1 cut(s) 756
BsnI GGCC 2 cut(s) 173, 499
BsoBI CYCGRG 1 cut(s) 98
Bsp1286I GDGCHC 1 cut(s) 559
Bsp13I TCCGGA 1 cut(s) 193
Bsp1407I TGTACA 1 cut(s) 393
Bsp143I GATC 2 cut(s) 166, 474
BspANI GGCC 2 cut(s) 173, 499
BspCNI CTCAG 7 cut(s) 34, 188, 439, 598, 687, 739, 766
BspEI TCCGGA 1 cut(s) 193
BspHI TCATGA 1 cut(s) 738
BspQI GCTCTTC 1 cut(s) 564
BspTI CTTAAG 1 cut(s) 406
BsrGI TGTACA 1 cut(s) 393
BssECI CCNNGG 1 cut(s) 48
BssMI GATC 2 cut(s) 166, 474
BssSI CACGAG 1 cut(s) 651
BssT1I CCWWGG 1 cut(s) 48
Bst2BI CACGAG 1 cut(s) 651
Bst6I CTCTTC 1 cut(s) 564
BstAFI CTTAAG 1 cut(s) 406
BstAPI GCANNNNNTGC 1 cut(s) 28
BstAUI TGTACA 1 cut(s) 393
BstC8I GCNNGC 1 cut(s) 555
BstDEI CTNAG 7 cut(s) 42, 175, 447, 606, 695, 747, 753
BstF5I GGATG 4 cut(s) 308, 335, 477, 544
BstHHI GCGC 2 cut(s) 73, 663
BstKTI GATC 2 cut(s) 169, 477
BstMAI GTCTC 1 cut(s) 756
BstMBI GATC 2 cut(s) 166, 474
BstMWI GCNNNNNNNGC 2 cut(s) 28, 296
BstNSI RCATGY 2 cut(s) 580, 598
BstSCI CCNGG 1 cut(s) 534
Bsu36I CCTNAGG 1 cut(s) 175
BsuRI GGCC 2 cut(s) 173, 499
BtsCI GGATG 4 cut(s) 308, 335, 477, 544
BtsI GCAGTG 1 cut(s) 261
BtsIMutI CAGTG 2 cut(s) 251, 261
Cac8I GCNNGC 1 cut(s) 555
CciI TCATGA 1 cut(s) 738
CfoI GCGC 2 cut(s) 73, 663
Csp6I GTAC 4 cut(s) 233, 394, 671, 758
CviAII CATG 6 cut(s) 23, 397, 577, 595, 739, 781
CviQI GTAC 4 cut(s) 233, 394, 671, 758
DdeI CTNAG 7 cut(s) 42, 175, 447, 606, 695, 747, 753
DpnI GATC 2 cut(s) 168, 476
DpnII GATC 2 cut(s) 166, 474
Eam1104I CTCTTC 1 cut(s) 564
EarI CTCTTC 1 cut(s) 564
Eco130I CCWWGG 1 cut(s) 48
Eco147I AGGCCT 1 cut(s) 173
Eco57I CTGAAG 2 cut(s) 227, 279
Eco81I CCTNAGG 1 cut(s) 175
Eco88I CYCGRG 1 cut(s) 98
EcoT14I CCWWGG 1 cut(s) 48
ErhI CCWWGG 1 cut(s) 48
FaeI CATG 6 cut(s) 26, 400, 580, 598, 742, 784
FalI AAGNNNNNCTT 2 cut(s) 112, 144
FatI CATG 6 cut(s) 22, 396, 576, 594, 738, 780
FokI GGATG 4 cut(s) 315, 342, 484, 551
FspAI RTGCGCAY 1 cut(s) 72
FspBI CTAG 5 cut(s) 279, 420, 546, 761, 796
FspI TGCGCA 1 cut(s) 72
GlaI GCGC 2 cut(s) 72, 662
GsuI CTGGAG 1 cut(s) 17
HaeIII GGCC 2 cut(s) 173, 499
HapII CCGG 3 cut(s) 194, 300, 535
HhaI GCGC 2 cut(s) 73, 663
Hin1II CATG 6 cut(s) 26, 400, 580, 598, 742, 784
Hin6I GCGC 2 cut(s) 71, 661
HinP1I GCGC 2 cut(s) 71, 661
HindIII AAGCTT 1 cut(s) 134
HinfI GANTC 5 cut(s) 44, 227, 488, 721, 749
HpaII CCGG 3 cut(s) 194, 300, 535
HphI GGTGA 2 cut(s) 87, 762
Hpy188I TCNGA 3 cut(s) 313, 607, 628
Hpy188III TCNNGA 8 cut(s) 34, 194, 269, 388, 446, 458, 569, 739
HpyAV CCTTC 1 cut(s) 439
HpyCH4V TGCA 8 cut(s) 155, 209, 353, 466, 598, 689, 712, 778
HpyF10VI GCNNNNNNNGC 2 cut(s) 28, 296
HpyF3I CTNAG 7 cut(s) 42, 175, 447, 606, 695, 747, 753
Hsp92II CATG 6 cut(s) 26, 400, 580, 598, 742, 784
HspAI GCGC 2 cut(s) 71, 661
Kpn2I TCCGGA 1 cut(s) 193
Kzo9I GATC 2 cut(s) 166, 474
LguI GCTCTTC 1 cut(s) 564
LmnI GCTCC 3 cut(s) 36, 125, 271
LweI GCATC 3 cut(s) 82, 299, 637
MaeI CTAG 5 cut(s) 279, 420, 546, 761, 796
MaeIII GTNAC 1 cut(s) 763
MalI GATC 2 cut(s) 168, 476
MboI GATC 2 cut(s) 166, 474
MboII GAAGA 3 cut(s) 285, 300, 551
MfeI CAATTG 1 cut(s) 507
MhlI GDGCHC 1 cut(s) 559
MluCI AATT 4 cut(s) 197, 256, 507, 700
MlyI GAGTC 4 cut(s) 53, 221, 497, 758
MnlI CCTC 7 cut(s) 184, 217, 445, 453, 687, 690, 690
MroI TCCGGA 1 cut(s) 193
MseI TTAA 1 cut(s) 407
MslI CAYNNNNRTG 2 cut(s) 66, 381
MspCI CTTAAG 1 cut(s) 406
MspI CCGG 3 cut(s) 194, 300, 535
MspR9I CCNGG 1 cut(s) 536
MunI CAATTG 1 cut(s) 507
MwoI GCNNNNNNNGC 2 cut(s) 28, 296
NciI CCSGG 1 cut(s) 536
NdeII GATC 2 cut(s) 166, 474
NlaIII CATG 6 cut(s) 26, 400, 580, 598, 742, 784
NsbI TGCGCA 1 cut(s) 72
NspI RCATGY 2 cut(s) 580, 598
PagI TCATGA 1 cut(s) 738
PceI AGGCCT 1 cut(s) 173
PciSI GCTCTTC 1 cut(s) 564
PfeI GAWTC 1 cut(s) 721
PfoI TCCNGGA 1 cut(s) 534
PleI GAGTC 4 cut(s) 52, 221, 496, 757
PpsI GAGTC 4 cut(s) 52, 221, 496, 757
RsaI GTAC 4 cut(s) 234, 395, 672, 759
RsaNI GTAC 4 cut(s) 233, 394, 671, 758
RseI CAYNNNNRTG 2 cut(s) 66, 381
SapI GCTCTTC 1 cut(s) 564
SaqAI TTAA 1 cut(s) 407
Sau3AI GATC 2 cut(s) 166, 474
SchI GAGTC 4 cut(s) 53, 221, 497, 758
ScrFI CCNGG 1 cut(s) 536
SduI GDGCHC 1 cut(s) 559
SfaNI GCATC 3 cut(s) 82, 299, 637
SmiMI CAYNNNNRTG 2 cut(s) 66, 381
SmlI CTYRAG 1 cut(s) 406
SmoI CTYRAG 1 cut(s) 406
SpeI ACTAGT 1 cut(s) 760
Sse9I AATT 4 cut(s) 197, 256, 507, 700
SseBI AGGCCT 1 cut(s) 173
SspMI CTAG 5 cut(s) 279, 420, 546, 761, 796
StuI AGGCCT 1 cut(s) 173
StyD4I CCNGG 1 cut(s) 534
StyI CCWWGG 1 cut(s) 48
TaqI TCGA 3 cut(s) 85, 570, 582
TasI AATT 4 cut(s) 197, 256, 507, 700
TatI WGTACW 2 cut(s) 232, 393
TfiI GAWTC 1 cut(s) 721
Tru1I TTAA 1 cut(s) 407
Tru9I TTAA 1 cut(s) 407
TscAI CASTG 2 cut(s) 258, 268
TspDTI ATGAA 4 cut(s) 71, 191, 200, 413
TspRI CASTG 2 cut(s) 258, 268
Vha464I CTTAAG 1 cut(s) 406
XapI RAATTY 2 cut(s) 197, 700
XceI RCATGY 2 cut(s) 580, 598
XspI CTAG 5 cut(s) 279, 420, 546, 761, 796
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.