Rmu_sc0016654.1_g000001

Leucine-rich repeat receptor-like tyrosine-protein kinase

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0016654.1
Physical Location & Seq
Reverse (-)
19 .. 303
285 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0016654.1_g000001.1.cds

Sequence Viewer

Length: 285 bp
atgcctgttgaaattgtgggctatcagaatttgactctgattgatctaagcacaaatagtctttacgggtctattcctcagggaatgggagagctttccaagctggaagttttgattctatcttcaaatatgttagatgggaaaatccccgccacacttgcctccatgagtagtctgttagaactccaacttggtcagaatcacttgaatggtgacattccaagcagggccggccctgtgagtttagaggctcaaggcgggaaaaaatttgaggccccaaaataa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.

Protein Analysis

94

Amino Acids

9.94

Weight (kDa)

4.87

Isoelectric Point (pI)

34.42

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0029644)

Species Orthologous Gene IDs
rosa_chinensis RchiOBHm_Chr1g0369711
rosa_multiflora Rmu_sc0016654.1_g000001

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 2 cut(s) 150, 258
AcsI RAATTY 2 cut(s) 28, 266
AgsI TTSAA 3 cut(s) 11, 126, 208
AjuI GAANNNNNNNTTGG 2 cut(s) 174, 206
AluBI AGCT 2 cut(s) 94, 103
AluI AGCT 2 cut(s) 94, 103
AoxI GGCC 3 cut(s) 228, 232, 273
ApoI RAATTY 2 cut(s) 28, 266
AspS9I GGNCC 3 cut(s) 228, 233, 274
AsuHPI GGTGA 1 cut(s) 224
AxyI CCTNAGG 1 cut(s) 78
BccI CCATC 1 cut(s) 131
BmgT120I GGNCC 3 cut(s) 228, 233, 274
BmiI GGNNCC 1 cut(s) 276
BpuEI CTTGAG 1 cut(s) 237
Bse118I RCCGGY 1 cut(s) 230
Bse21I CCTNAGG 1 cut(s) 78
BseMII CTCAG 1 cut(s) 92
BshFI GGCC 3 cut(s) 230, 234, 275
BsiSI CCGG 1 cut(s) 231
BsnI GGCC 3 cut(s) 230, 234, 275
Bsp143I GATC 1 cut(s) 43
BspACI CCGC 2 cut(s) 150, 258
BspANI GGCC 3 cut(s) 230, 234, 275
BspCNI CTCAG 1 cut(s) 91
BspLI GGNNCC 1 cut(s) 276
BsrFI RCCGGY 1 cut(s) 230
BssAI RCCGGY 1 cut(s) 230
BssMI GATC 1 cut(s) 43
BstC8I GCNNGC 1 cut(s) 232
BstDEI CTNAG 2 cut(s) 47, 78
BstKTI GATC 1 cut(s) 46
BstMBI GATC 1 cut(s) 43
BstMWI GCNNNNNNNGC 3 cut(s) 100, 158, 231
Bsu36I CCTNAGG 1 cut(s) 78
BsuRI GGCC 3 cut(s) 230, 234, 275
Cac8I GCNNGC 1 cut(s) 232
Cfr10I RCCGGY 1 cut(s) 230
Cfr13I GGNCC 3 cut(s) 228, 233, 274
CviAII CATG 1 cut(s) 166
CviJI RGCY 7 cut(s) 21, 94, 103, 230, 234, 251, 275
CviKI_1 RGCY 7 cut(s) 21, 94, 103, 230, 234, 251, 275
DdeI CTNAG 2 cut(s) 47, 78
DpnI GATC 1 cut(s) 45
DpnII GATC 1 cut(s) 43
Eco81I CCTNAGG 1 cut(s) 78
EcoO109I RGGNCCY 1 cut(s) 274
FaeI CATG 1 cut(s) 169
FaiI YATR 2 cut(s) 131, 167
FatI CATG 1 cut(s) 165
FauI CCCGC 2 cut(s) 157, 251
FseI GGCCGGCC 1 cut(s) 234
HaeIII GGCC 3 cut(s) 230, 234, 275
HapII CCGG 1 cut(s) 231
Hin1II CATG 1 cut(s) 169
HinfI GANTC 3 cut(s) 34, 115, 199
HpaII CCGG 1 cut(s) 231
HphI GGTGA 1 cut(s) 224
Hpy188I TCNGA 3 cut(s) 27, 39, 198
HpyF10VI GCNNNNNNNGC 3 cut(s) 100, 158, 231
HpyF3I CTNAG 2 cut(s) 47, 78
Hsp92II CATG 1 cut(s) 169
KroI GCCGGC 1 cut(s) 230
KroNI GCCGGC 1 cut(s) 232
Kzo9I GATC 1 cut(s) 43
LpnPI CCDG 6 cut(s) 18, 65, 89, 211, 244, 249
MaeIII GTNAC 1 cut(s) 212
MalI GATC 1 cut(s) 45
MboI GATC 1 cut(s) 43
MboII GAAGA 1 cut(s) 114
MluCI AATT 3 cut(s) 12, 28, 266
MlyI GAGTC 1 cut(s) 28
MmeI TCCRAC 1 cut(s) 211
MnlI CCTC 4 cut(s) 87, 172, 241, 265
MroNI GCCGGC 1 cut(s) 230
MslI CAYNNNNRTG 1 cut(s) 207
MspI CCGG 1 cut(s) 231
MwoI GCNNNNNNNGC 3 cut(s) 100, 158, 231
NaeI GCCGGC 1 cut(s) 232
NdeII GATC 1 cut(s) 43
NgoMIV GCCGGC 1 cut(s) 230
NlaIII CATG 1 cut(s) 169
NlaIV GGNNCC 1 cut(s) 276
NmuCI GTSAC 1 cut(s) 212
PdiI GCCGGC 1 cut(s) 232
PfeI GAWTC 2 cut(s) 115, 199
PleI GAGTC 1 cut(s) 28
PpsI GAGTC 1 cut(s) 28
PspN4I GGNNCC 1 cut(s) 276
PspPI GGNCC 3 cut(s) 228, 233, 274
RigI GGCCGGCC 1 cut(s) 234
RseI CAYNNNNRTG 1 cut(s) 207
Sau3AI GATC 1 cut(s) 43
Sau96I GGNCC 3 cut(s) 228, 233, 274
SchI GAGTC 1 cut(s) 28
SetI ASST 2 cut(s) 96, 105
SmiMI CAYNNNNRTG 1 cut(s) 207
SmlI CTYRAG 1 cut(s) 252
SmoI CTYRAG 1 cut(s) 252
Sse9I AATT 3 cut(s) 12, 28, 266
SsiI CCGC 2 cut(s) 150, 258
TasI AATT 3 cut(s) 12, 28, 266
TfiI GAWTC 2 cut(s) 115, 199
TseFI GTSAC 1 cut(s) 212
Tsp45I GTSAC 1 cut(s) 212
XapI RAATTY 2 cut(s) 28, 266
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.