Rmu_sc0019437.1_g000001

membrane

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0019437.1
OG0024645
Physical Location & Seq
Forward (+)
703 .. 1801
1099 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0019437.1_g000001.1.cds

Sequence Viewer

Length: 483 bp
atgattcctggaactgtgttcatgtcgttgcttgctggttcccttttcggagtcttcaaaggtgtagctttggtggtgttcaatgccactgctggtgcttcttcttgctatttcttgtcaaaggtgatagggaggccccttgccacttctctttggcccgacaagctcctgtttttccaaaaccaggtggctaaaagaagacaagggttgctgaactacatgttgtttctccgattaactccaaccttgccaaacacatttattaatgttgcttcaccaatagtcgatgtgccttatcatattttcttcctggcaacctcaattggtctgatacctgctgcttatgtcactgtcagggctggactagctcttggagaattgcgatctcttggggatctctatgacttcaactcaatagccaccttgttcttcatcggagttgtctcagttacgcccacattagtgagcaagaacaaatcatag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
SNARE_assoc

Protein Analysis

160

Amino Acids

17.31

Weight (kDa)

9.93

Isoelectric Point (pI)

37.03

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0024645)

Species Orthologous Gene IDs
pyrus_communis pycom06g03040
rosa_multiflora Rmu_sc0019437.1_g000001
rosa_wichuraiana Rw7G021540

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 343
AclWI GGATC 1 cut(s) 402
AfiI CCNNNNNNNGG 1 cut(s) 184
AflIII ACRYGT 1 cut(s) 219
AgsI TTSAA 3 cut(s) 58, 82, 409
AjnI CCWGG 3 cut(s) 7, 183, 309
AleI CACNNNNGTG 1 cut(s) 461
AluBI AGCT 3 cut(s) 68, 166, 368
AluI AGCT 3 cut(s) 68, 166, 368
Alw26I GTCTC 1 cut(s) 448
AlwI GGATC 1 cut(s) 402
AoxI GGCC 2 cut(s) 134, 155
ApeKI GCWGC 1 cut(s) 338
AseI ATTAAT 1 cut(s) 264
AspS9I GGNCC 2 cut(s) 135, 156
AsuHPI GGTGA 2 cut(s) 136, 267
BbsI GAAGAC 2 cut(s) 46, 205
BbvI GCAGC 1 cut(s) 325
BciT130I CCWGG 3 cut(s) 9, 185, 311
BcoDI GTCTC 1 cut(s) 448
BfaI CTAG 1 cut(s) 365
BfuAI ACCTGC 1 cut(s) 343
BisI GCNGC 1 cut(s) 339
BlsI GCNGC 1 cut(s) 340
Bme1390I CCNGG 3 cut(s) 9, 185, 311
BmgT120I GGNCC 2 cut(s) 135, 156
BmiI GGNNCC 2 cut(s) 40, 137
BmrFI CCNGG 3 cut(s) 9, 185, 311
BpiI GAAGAC 2 cut(s) 46, 205
Bsc4I CCNNNNNNNGG 1 cut(s) 184
BseBI CCWGG 3 cut(s) 9, 185, 311
BseLI CCNNNNNNNGG 1 cut(s) 184
BseMII CTCAG 1 cut(s) 459
BseXI GCAGC 1 cut(s) 325
BshFI GGCC 2 cut(s) 136, 157
BslI CCNNNNNNNGG 1 cut(s) 184
BsmAI GTCTC 1 cut(s) 448
BsnI GGCC 2 cut(s) 136, 157
Bsp143I GATC 2 cut(s) 383, 394
BspANI GGCC 2 cut(s) 136, 157
BspCNI CTCAG 1 cut(s) 458
BspLI GGNNCC 2 cut(s) 40, 137
BspMI ACCTGC 1 cut(s) 343
BspPI GGATC 1 cut(s) 402
BssMI GATC 2 cut(s) 383, 394
Bst2UI CCWGG 3 cut(s) 9, 185, 311
Bst4CI ACNGT 2 cut(s) 16, 352
BstC8I GCNNGC 1 cut(s) 33
BstDEI CTNAG 1 cut(s) 445
BstKTI GATC 2 cut(s) 386, 397
BstMAI GTCTC 1 cut(s) 448
BstMBI GATC 2 cut(s) 383, 394
BstMWI GCNNNNNNNGC 2 cut(s) 163, 365
BstNI CCWGG 3 cut(s) 9, 185, 311
BstNSI RCATGY 1 cut(s) 223
BstSCI CCNGG 3 cut(s) 7, 183, 309
BstV1I GCAGC 1 cut(s) 325
BstV2I GAAGAC 2 cut(s) 46, 205
BstX2I RGATCY 1 cut(s) 394
BstYI RGATCY 1 cut(s) 394
BsuRI GGCC 2 cut(s) 136, 157
BtsI GCAGTG 1 cut(s) 87
BtsIMutI CAGTG 2 cut(s) 87, 348
BveI ACCTGC 1 cut(s) 343
Cac8I GCNNGC 1 cut(s) 33
Cfr13I GGNCC 2 cut(s) 135, 156
CsiI ACCWGGT 1 cut(s) 183
CviAII CATG 2 cut(s) 22, 220
CviJI RGCY 8 cut(s) 68, 136, 157, 166, 191, 359, 368, 419
CviKI_1 RGCY 8 cut(s) 68, 136, 157, 166, 191, 359, 368, 419
DdeI CTNAG 1 cut(s) 445
DpnI GATC 2 cut(s) 385, 396
DpnII GATC 2 cut(s) 383, 394
EcoO109I RGGNCCY 1 cut(s) 135
EcoRII CCWGG 3 cut(s) 7, 183, 309
FaeI CATG 2 cut(s) 25, 223
FaiI YATR 6 cut(s) 23, 221, 300, 345, 402, 481
FatI CATG 2 cut(s) 21, 219
Fnu4HI GCNGC 1 cut(s) 339
Fsp4HI GCNGC 1 cut(s) 339
FspBI CTAG 1 cut(s) 365
GluI GCNGC 1 cut(s) 339
HaeIII GGCC 2 cut(s) 136, 157
Hin1II CATG 2 cut(s) 25, 223
HinfI GANTC 2 cut(s) 4, 51
HphI GGTGA 2 cut(s) 136, 267
Hpy188I TCNGA 4 cut(s) 50, 233, 330, 437
HpyCH4III ACNGT 2 cut(s) 16, 352
HpyF10VI GCNNNNNNNGC 2 cut(s) 163, 365
HpyF3I CTNAG 1 cut(s) 445
Hsp92II CATG 2 cut(s) 25, 223
Kzo9I GATC 2 cut(s) 383, 394
LmnI GCTCC 1 cut(s) 171
Lsp1109I GCAGC 1 cut(s) 325
MabI ACCWGGT 1 cut(s) 183
MaeI CTAG 1 cut(s) 365
MaeIII GTNAC 2 cut(s) 346, 448
MalI GATC 2 cut(s) 385, 396
MboI GATC 2 cut(s) 383, 394
MboII GAAGA 5 cut(s) 46, 93, 210, 298, 421
MfeI CAATTG 1 cut(s) 321
MflI RGATCY 1 cut(s) 394
MluCI AATT 2 cut(s) 321, 377
MlyI GAGTC 1 cut(s) 60
MmeI TCCRAC 1 cut(s) 266
MnlI CCTC 2 cut(s) 126, 328
MseI TTAA 2 cut(s) 236, 264
MslI CAYNNNNRTG 1 cut(s) 461
MspR9I CCNGG 3 cut(s) 9, 185, 311
MunI CAATTG 1 cut(s) 321
MvaI CCWGG 3 cut(s) 9, 185, 311
MwoI GCNNNNNNNGC 2 cut(s) 163, 365
NdeII GATC 2 cut(s) 383, 394
NlaIII CATG 2 cut(s) 25, 223
NlaIV GGNNCC 2 cut(s) 40, 137
NmuCI GTSAC 1 cut(s) 346
NspI RCATGY 1 cut(s) 223
OliI CACNNNNGTG 1 cut(s) 461
PciI ACATGT 1 cut(s) 219
PfeI GAWTC 1 cut(s) 4
PfoI TCCNGGA 1 cut(s) 7
PkrI GCNGC 1 cut(s) 340
PleI GAGTC 1 cut(s) 59
PpsI GAGTC 1 cut(s) 59
PscI ACATGT 1 cut(s) 219
PshBI ATTAAT 1 cut(s) 264
Psp6I CCWGG 3 cut(s) 7, 183, 309
PspGI CCWGG 3 cut(s) 7, 183, 309
PspN4I GGNNCC 2 cut(s) 40, 137
PspPI GGNCC 2 cut(s) 135, 156
PsuI RGATCY 1 cut(s) 394
RseI CAYNNNNRTG 1 cut(s) 461
SaqAI TTAA 2 cut(s) 236, 264
SatI GCNGC 1 cut(s) 339
Sau3AI GATC 2 cut(s) 383, 394
Sau96I GGNCC 2 cut(s) 135, 156
SchI GAGTC 1 cut(s) 60
ScrFI CCNGG 3 cut(s) 9, 185, 311
SexAI ACCWGGT 1 cut(s) 183
SmiMI CAYNNNNRTG 1 cut(s) 461
Sse9I AATT 2 cut(s) 321, 377
SspMI CTAG 1 cut(s) 365
StyD4I CCNGG 3 cut(s) 7, 183, 309
TaaI ACNGT 2 cut(s) 16, 352
TaqI TCGA 1 cut(s) 285
TasI AATT 2 cut(s) 321, 377
TfiI GAWTC 1 cut(s) 4
Tru1I TTAA 2 cut(s) 236, 264
Tru9I TTAA 2 cut(s) 236, 264
TscAI CASTG 2 cut(s) 94, 355
TseFI GTSAC 1 cut(s) 346
TseI GCWGC 1 cut(s) 338
Tsp45I GTSAC 1 cut(s) 346
TspDTI ATGAA 2 cut(s) 10, 421
TspRI CASTG 2 cut(s) 94, 355
VspI ATTAAT 1 cut(s) 264
XceI RCATGY 1 cut(s) 223
XspI CTAG 1 cut(s) 365
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.