Rmu_sc0020622.1_g000001

Ethylene-overproduction protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0020622.1
OG0024633
Physical Location & Seq
Forward (+)
4778 .. 6624
1847 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0020622.1_g000001.1.cds

Sequence Viewer

Length: 813 bp
atgcatagtctgcgattggctcgaaatcattctacttctgaacatgaacggcttgtgtatgaaggatggatattgtatgacactggccatcgtgaagaagcattggcaaaggctgaggagtccatttcacttcaaagatcattcgaggcatttttcctaaaggcttatgctttagcagactcaaatcttgattctgagtcttcaacatatgtgatacagcttctggaggaagcactcagatgcccttcggacggccttagaaaaggacaagctctaaataatttaggaagtgtctacgtagattctgagaagctggatcttgctgctgactgctacacaaatgcacttaacattaagcatacaagagcacatcaaggtctagcacgagtatatcatcttaaaaatcaacgcaaagctgcatatgatgagatgacaaagctgatagagaaggctcgcaacaatgcatcagcttatgagaaacgttcagaatactgtgatcgtgacatggcaaagaatgatctaagtatggcaacacaattagatccattgaggacatatccgtacagatatagggcagcagttttgatggatgaccacaaagaagcagaagctattgaagagctaagtaaggccatagctttcaagccggacctccagcttctacatcttcgagcagcattccacgaatctatgagtgattttgtgtccactgtccgagactgtgaagcagccctctgccttgaccccaaccatgccgacactcatgaactctatggtaaagcacgggagcgcttaaatgaacaacaaaggtga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
BTB TPR_8

Protein Analysis

270

Amino Acids

30.95

Weight (kDa)

5.86

Isoelectric Point (pI)

40.96

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0024633)

Species Orthologous Gene IDs
pyrus_communis pycom04g14580
rosa_multiflora Rmu_co8296871.1_g000001 Rmu_sc0020622.1_g000001

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 294
AclI AACGTT 1 cut(s) 481
AclWI GGATC 2 cut(s) 324, 536
AcoI YGGCCR 1 cut(s) 85
AfaI GTAC 1 cut(s) 563
AfeI AGCGCT 1 cut(s) 791
AfiI CCNNNNNNNGG 1 cut(s) 251
AgsI TTSAA 4 cut(s) 134, 204, 617, 643
Alw21I GWGCWC 1 cut(s) 370
Alw26I GTCTC 1 cut(s) 711
AlwI GGATC 2 cut(s) 324, 536
AlwNI CAGNNNCTG 1 cut(s) 223
Aor51HI AGCGCT 1 cut(s) 791
AoxI GGCC 3 cut(s) 85, 253, 630
ApeKI GCWGC 5 cut(s) 323, 416, 575, 674, 728
Asp700I GAANNNNTTC 1 cut(s) 28
AspLEI GCGC 1 cut(s) 792
AspS9I GGNCC 1 cut(s) 649
AvaII GGWCC 1 cut(s) 649
BalI TGGCCA 1 cut(s) 87
BauI CACGAG 1 cut(s) 384
BbsI GAAGAC 1 cut(s) 192
Bbv12I GWGCWC 1 cut(s) 370
BbvCI CCTCAGC 1 cut(s) 114
BbvI GCAGC 5 cut(s) 310, 403, 587, 686, 740
BccI CCATC 3 cut(s) 60, 96, 580
BceAI ACGGC 2 cut(s) 65, 268
BcoDI GTCTC 1 cut(s) 711
BfaI CTAG 1 cut(s) 380
BfoI RGCGCY 1 cut(s) 793
BisI GCNGC 5 cut(s) 324, 417, 576, 675, 729
BlsI GCNGC 5 cut(s) 325, 418, 577, 676, 730
Bme18I GGWCC 1 cut(s) 649
BmgT120I GGNCC 1 cut(s) 649
BmsI GCATC 2 cut(s) 230, 473
BpiI GAAGAC 1 cut(s) 192
BpmI CTGGAG 2 cut(s) 245, 638
Bpu10I CCTNAGC 1 cut(s) 114
BsaAI YACGTR 1 cut(s) 298
Bsc4I CCNNNNNNNGG 1 cut(s) 251
Bse1I ACTGG 1 cut(s) 88
BseGI GGATG 2 cut(s) 71, 595
BseLI CCNNNNNNNGG 1 cut(s) 251
BseMII CTCAG 4 cut(s) 105, 186, 250, 297
BseNI ACTGG 1 cut(s) 88
BseRI GAGGAG 1 cut(s) 131
BseXI GCAGC 5 cut(s) 310, 403, 587, 686, 740
BshFI GGCC 3 cut(s) 87, 255, 632
BsiHKAI GWGCWC 1 cut(s) 370
BsiSI CCGG 1 cut(s) 647
BslI CCNNNNNNNGG 1 cut(s) 251
BsmAI GTCTC 1 cut(s) 711
BsmI GAATGC 1 cut(s) 677
BsnI GGCC 3 cut(s) 87, 255, 632
Bsp1286I GDGCHC 1 cut(s) 370
Bsp143I GATC 5 cut(s) 137, 316, 496, 517, 541
BspANI GGCC 3 cut(s) 87, 255, 632
BspCNI CTCAG 4 cut(s) 106, 187, 249, 298
BspHI TCATGA 1 cut(s) 763
BspPI GGATC 2 cut(s) 324, 536
BspQI GCTCTTC 1 cut(s) 612
BsrI ACTGG 1 cut(s) 88
BssMI GATC 5 cut(s) 137, 316, 496, 517, 541
BssSI CACGAG 1 cut(s) 384
Bst2BI CACGAG 1 cut(s) 384
Bst4CI ACNGT 3 cut(s) 494, 712, 722
Bst6I CTCTTC 1 cut(s) 612
BstAPI GCANNNNNTGC 1 cut(s) 10
BstBAI YACGTR 1 cut(s) 298
BstC8I GCNNGC 1 cut(s) 454
BstDEI CTNAG 7 cut(s) 114, 195, 236, 257, 306, 521, 623
BstF5I GGATG 2 cut(s) 71, 595
BstH2I RGCGCY 1 cut(s) 793
BstHHI GCGC 1 cut(s) 792
BstKTI GATC 5 cut(s) 140, 319, 499, 520, 544
BstMAI GTCTC 1 cut(s) 711
BstMBI GATC 5 cut(s) 137, 316, 496, 517, 541
BstMWI GCNNNNNNNGC 1 cut(s) 10
BstSNI TACGTA 1 cut(s) 298
BstV1I GCAGC 5 cut(s) 310, 403, 587, 686, 740
BstV2I GAAGAC 1 cut(s) 192
BstX2I RGATCY 2 cut(s) 316, 541
BstYI RGATCY 2 cut(s) 316, 541
BsuRI GGCC 3 cut(s) 87, 255, 632
BtsCI GGATG 2 cut(s) 71, 595
BtsIMutI CAGTG 2 cut(s) 81, 708
Cac8I GCNNGC 1 cut(s) 454
CaiI CAGNNNCTG 1 cut(s) 223
CciI TCATGA 1 cut(s) 763
CfoI GCGC 1 cut(s) 792
Cfr13I GGNCC 1 cut(s) 649
Csp6I GTAC 1 cut(s) 562
CviAII CATG 4 cut(s) 44, 505, 752, 764
CviQI GTAC 1 cut(s) 562
DdeI CTNAG 7 cut(s) 114, 195, 236, 257, 306, 521, 623
DpnI GATC 5 cut(s) 139, 318, 498, 519, 543
DpnII GATC 5 cut(s) 137, 316, 496, 517, 541
EaeI YGGCCR 1 cut(s) 85
Eam1104I CTCTTC 1 cut(s) 612
EarI CTCTTC 1 cut(s) 612
Eco105I TACGTA 1 cut(s) 298
Eco47I GGWCC 1 cut(s) 649
Eco47III AGCGCT 1 cut(s) 791
EcoT22I ATGCAT 2 cut(s) 6, 466
FaeI CATG 4 cut(s) 47, 508, 755, 767
FatI CATG 4 cut(s) 43, 504, 751, 763
FauNDI CATATG 2 cut(s) 208, 421
FblI GTMKAC 1 cut(s) 294
Fnu4HI GCNGC 5 cut(s) 324, 417, 576, 675, 729
FokI GGATG 2 cut(s) 78, 602
Fsp4HI GCNGC 5 cut(s) 324, 417, 576, 675, 729
FspBI CTAG 1 cut(s) 380
GlaI GCGC 1 cut(s) 791
GluI GCNGC 5 cut(s) 324, 417, 576, 675, 729
GsuI CTGGAG 2 cut(s) 245, 638
HaeII RGCGCY 1 cut(s) 793
HaeIII GGCC 3 cut(s) 87, 255, 632
HapII CCGG 1 cut(s) 647
HhaI GCGC 1 cut(s) 792
Hin1II CATG 4 cut(s) 47, 508, 755, 767
Hin6I GCGC 1 cut(s) 790
HinP1I GCGC 1 cut(s) 790
HinfI GANTC 6 cut(s) 119, 179, 191, 197, 302, 686
HpaII CCGG 1 cut(s) 647
Hpy166II GTNNAC 2 cut(s) 295, 708
Hpy188I TCNGA 7 cut(s) 40, 196, 239, 250, 307, 487, 716
Hpy188III TCNNGA 5 cut(s) 92, 188, 224, 500, 764
Hpy8I GTNNAC 2 cut(s) 295, 708
HpyAV CCTTC 3 cut(s) 56, 255, 442
HpyCH4III ACNGT 3 cut(s) 494, 712, 722
HpyCH4IV ACGT 2 cut(s) 297, 481
HpyCH4V TGCA 4 cut(s) 4, 344, 419, 464
HpyF10VI GCNNNNNNNGC 1 cut(s) 10
HpyF3I CTNAG 7 cut(s) 114, 195, 236, 257, 306, 521, 623
HpySE526I ACGT 2 cut(s) 297, 481
Hsp92II CATG 4 cut(s) 47, 508, 755, 767
HspAI GCGC 1 cut(s) 790
Kzo9I GATC 5 cut(s) 137, 316, 496, 517, 541
LguI GCTCTTC 1 cut(s) 612
LmnI GCTCC 1 cut(s) 787
LpnPI CCDG 5 cut(s) 69, 209, 299, 660, 668
Lsp1109I GCAGC 5 cut(s) 310, 403, 587, 686, 740
LweI GCATC 2 cut(s) 230, 473
MaeI CTAG 1 cut(s) 380
MaeII ACGT 2 cut(s) 297, 481
MaeIII GTNAC 1 cut(s) 500
MalI GATC 5 cut(s) 139, 318, 498, 519, 543
MboI GATC 5 cut(s) 137, 316, 496, 517, 541
MboII GAAGA 4 cut(s) 107, 192, 629, 659
MflI RGATCY 2 cut(s) 316, 541
MhlI GDGCHC 1 cut(s) 370
MlsI TGGCCA 1 cut(s) 87
MluCI AATT 2 cut(s) 280, 536
MluNI TGGCCA 1 cut(s) 87
MlyI GAGTC 3 cut(s) 128, 173, 206
MnlI CCTC 6 cut(s) 109, 139, 220, 543, 662, 743
Mox20I TGGCCA 1 cut(s) 87
Mph1103I ATGCAT 2 cut(s) 6, 466
MroXI GAANNNNTTC 1 cut(s) 28
MscI TGGCCA 1 cut(s) 87
MseI TTAA 4 cut(s) 348, 354, 399, 794
MslI CAYNNNNRTG 1 cut(s) 238
Msp20I TGGCCA 1 cut(s) 87
MspI CCGG 1 cut(s) 647
Mva1269I GAATGC 1 cut(s) 677
MwoI GCNNNNNNNGC 1 cut(s) 10
NdeI CATATG 2 cut(s) 208, 421
NdeII GATC 5 cut(s) 137, 316, 496, 517, 541
NlaIII CATG 4 cut(s) 47, 508, 755, 767
NmuCI GTSAC 1 cut(s) 500
NsiI ATGCAT 2 cut(s) 6, 466
PagI TCATGA 1 cut(s) 763
PciSI GCTCTTC 1 cut(s) 612
PctI GAATGC 1 cut(s) 677
PdmI GAANNNNTTC 1 cut(s) 28
PfeI GAWTC 3 cut(s) 191, 302, 686
PkrI GCNGC 5 cut(s) 325, 418, 577, 676, 730
PleI GAGTC 3 cut(s) 127, 173, 205
PpsI GAGTC 3 cut(s) 127, 173, 205
Ppu21I YACGTR 1 cut(s) 298
Psp1406I AACGTT 1 cut(s) 481
PspPI GGNCC 1 cut(s) 649
PstNI CAGNNNCTG 1 cut(s) 223
PsuI RGATCY 2 cut(s) 316, 541
RsaI GTAC 1 cut(s) 563
RsaNI GTAC 1 cut(s) 562
RseI CAYNNNNRTG 1 cut(s) 238
SapI GCTCTTC 1 cut(s) 612
SaqAI TTAA 4 cut(s) 348, 354, 399, 794
SatI GCNGC 5 cut(s) 324, 417, 576, 675, 729
Sau3AI GATC 5 cut(s) 137, 316, 496, 517, 541
Sau96I GGNCC 1 cut(s) 649
SchI GAGTC 3 cut(s) 128, 173, 206
SduI GDGCHC 1 cut(s) 370
SfaNI GCATC 2 cut(s) 230, 473
SinI GGWCC 1 cut(s) 649
SmiMI CAYNNNNRTG 1 cut(s) 238
SnaBI TACGTA 1 cut(s) 298
Sse9I AATT 2 cut(s) 280, 536
SspMI CTAG 1 cut(s) 380
TaaI ACNGT 3 cut(s) 494, 712, 722
TaiI ACGT 2 cut(s) 300, 484
TaqI TCGA 3 cut(s) 22, 144, 670
TasI AATT 2 cut(s) 280, 536
TfiI GAWTC 3 cut(s) 191, 302, 686
Tru1I TTAA 4 cut(s) 348, 354, 399, 794
Tru9I TTAA 4 cut(s) 348, 354, 399, 794
TscAI CASTG 2 cut(s) 88, 715
TseFI GTSAC 1 cut(s) 500
TseI GCWGC 5 cut(s) 323, 416, 575, 674, 728
Tsp45I GTSAC 1 cut(s) 500
TspDTI ATGAA 4 cut(s) 60, 75, 780, 813
TspGWI ACGGA 1 cut(s) 549
TspRI CASTG 2 cut(s) 88, 715
VpaK11BI GGWCC 1 cut(s) 649
XmiI GTMKAC 1 cut(s) 294
XmnI GAANNNNTTC 1 cut(s) 28
XspI CTAG 1 cut(s) 380
Zsp2I ATGCAT 2 cut(s) 6, 466
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.