Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0024549.1

Orthogroup ID

OG0031538

Physical Location & Seq

Genomic Coordinates Forward (+)

24 .. 1136

Gene Structure 1113 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0024549.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 204 bp

atgcaaggagagataaccgatgtaagcaccagtgaccttttgcagatacctcctgcttcctgtagggagagagagttgcaatctctggtgattaatctgcaacagagtgttgggaatcttgttgaacaattacaaagacagaagatgaaaaatgcccagttagaaagacaattgaatgccttggccaacaaagacaagatatga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0001932 GO:0001934 GO:0003674 GO:0003824 GO:0004672 GO:0004674 GO:0005575 GO:0005622 GO:0005623 GO:0005737 GO:0006464 GO:0006468 GO:0006793 GO:0006796 GO:0006807 GO:0006950 GO:0007154 GO:0007165 GO:0007346 GO:0008150 GO:0008152 GO:0009893 GO:0009987 GO:0010562 GO:0010604 GO:0016301 GO:0016310 GO:0016740 GO:0016772 GO:0016773 GO:0019220 GO:0019222 GO:0019538 GO:0023014 GO:0023052 GO:0031098 GO:0031323 GO:0031325 GO:0031399 GO:0031401 GO:0032147 GO:0032268 GO:0032270 GO:0033554 GO:0033674 GO:0035556 GO:0036211 GO:0042325 GO:0042327 GO:0043085 GO:0043170 GO:0043412 GO:0043549 GO:0044093 GO:0044237 GO:0044238 GO:0044260 GO:0044267 GO:0044424 GO:0044464 GO:0045859 GO:0045860 GO:0045937 GO:0048518 GO:0048522 GO:0050789 GO:0050790 GO:0050794 GO:0050896 GO:0051171 GO:0051173 GO:0051174 GO:0051246 GO:0051247 GO:0051338 GO:0051347 GO:0051716 GO:0051726 GO:0060255 GO:0065007 GO:0065009 GO:0071704 GO:0080090 GO:0140096 GO:1901564

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

Pkinase

Protein Analysis

67

Amino Acids

7.57

Weight (kDa)

6.15

Isoelectric Point (pI)

68.07

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0031538)

Species	Orthologous Gene IDs
rosa_multiflora	Rmu_sc0024549.1_g000001 Rmu_sc0025855.1_g000007

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AcoI	YGGCCR	1 cut(s)	183
AgsI	TTSAA	2 cut(s)	125, 175
AoxI	GGCC	1 cut(s)	183
AseI	ATTAAT	1 cut(s)	93
AsuHPI	GGTGA	1 cut(s)	100
BalI	TGGCCA	1 cut(s)	185
BfmI	CTRYAG	1 cut(s)	61
BmrI	ACTGGG	1 cut(s)	151
BmuI	ACTGGG	1 cut(s)	151
BsaJI	CCNNGG	1 cut(s)	180
BsaXI	ACNNNNNCTCC	2 cut(s)	59, 89
Bse1I	ACTGG	2 cut(s)	30, 157
BseDI	CCNNGG	1 cut(s)	180
BseNI	ACTGG	2 cut(s)	30, 157
BshFI	GGCC	1 cut(s)	185
BsmI	GAATGC	1 cut(s)	181
BsnI	GGCC	1 cut(s)	185
BspANI	GGCC	1 cut(s)	185
BsrI	ACTGG	2 cut(s)	30, 157
BssECI	CCNNGG	1 cut(s)	180
BssT1I	CCWWGG	1 cut(s)	180
BstSFI	CTRYAG	1 cut(s)	61
BsuRI	GGCC	1 cut(s)	185
BtsIMutI	CAGTG	1 cut(s)	37
CviJI	RGCY	1 cut(s)	185
CviKI_1	RGCY	1 cut(s)	185
EaeI	YGGCCR	1 cut(s)	183
Eco130I	CCWWGG	1 cut(s)	180
EcoT14I	CCWWGG	1 cut(s)	180
ErhI	CCWWGG	1 cut(s)	180
FaiI	YATR	1 cut(s)	202
HaeIII	GGCC	1 cut(s)	185
HinfI	GANTC	1 cut(s)	115
HphI	GGTGA	1 cut(s)	100
HpyCH4V	TGCA	4 cut(s)	4, 43, 79, 100
LpnPI	CCDG	5 cut(s)	43, 66, 71, 73, 170
MaeIII	GTNAC	1 cut(s)	32
MboII	GAAGA	1 cut(s)	154
MfeI	CAATTG	1 cut(s)	170
MlsI	TGGCCA	1 cut(s)	185
MluCI	AATT	2 cut(s)	128, 170
MluNI	TGGCCA	1 cut(s)	185
MnlI	CCTC	1 cut(s)	60
Mox20I	TGGCCA	1 cut(s)	185
MscI	TGGCCA	1 cut(s)	185
MseI	TTAA	1 cut(s)	93
Msp20I	TGGCCA	1 cut(s)	185
MunI	CAATTG	1 cut(s)	170
Mva1269I	GAATGC	1 cut(s)	181
NmuCI	GTSAC	1 cut(s)	32
PctI	GAATGC	1 cut(s)	181
PfeI	GAWTC	1 cut(s)	115
PshBI	ATTAAT	1 cut(s)	93
SaqAI	TTAA	1 cut(s)	93
SetI	ASST	2 cut(s)	39, 52
SfcI	CTRYAG	1 cut(s)	61
SgeI	CNNG	8 cut(s)	17, 42, 65, 72, 98, 131, 169, 193
Sse9I	AATT	2 cut(s)	128, 170
StyI	CCWWGG	1 cut(s)	180
TasI	AATT	2 cut(s)	128, 170
TfiI	GAWTC	1 cut(s)	115
Tru1I	TTAA	1 cut(s)	93
Tru9I	TTAA	1 cut(s)	93
TscAI	CASTG	1 cut(s)	37
TseFI	GTSAC	1 cut(s)	32
Tsp45I	GTSAC	1 cut(s)	32
TspDTI	ATGAA	1 cut(s)	161
TspRI	CASTG	1 cut(s)	37
VspI	ATTAAT	1 cut(s)	93

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.