Rmu_sc0024666.1_g000001

G-type lectin S-receptor-like serine threonine-protein kinase

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0024666.1
OG0029281
Physical Location & Seq
Forward (+)
184 .. 672
489 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0024666.1_g000001.1.cds

Sequence Viewer

Length: 402 bp
atgcgaagaaaattgttagattggcctaagcgcttccatattatttgcggaattgctagggggcttctctatcttcatcaggactccaggctgaggattatacacagagatctaaaagcaagcaatgtcttgcttgatcgtgagatgaaccccaaaatctcagattttggtcttgctagaacttttggtggtgaccaaactgaaggaaacacaaacagagtagttggaacatatggttacatggcccctgaatatgctgttgaagggcagttctcagtaaaatccgatgtctttagctttggtattttactgctggagctgataagtggaaagaaaagtaaagggttctatcacttgaaccacgacctgaatcttattggaaatgtaagtttaagcacaagc
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
B_lectin DUF3403 PAN_2 Pkinase_Tyr S_locus_glycop

Protein Analysis

134

Amino Acids

15.17

Weight (kDa)

9.51

Isoelectric Point (pI)

30.05

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0029281)

Species Orthologous Gene IDs
pyrus_communis pycom05g19910
rosa_multiflora Rmu_sc0024666.1_g000001

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 48
AcuI CTGAAG 1 cut(s) 222
AfeI AGCGCT 1 cut(s) 32
AfiI CCNNNNNNNGG 1 cut(s) 93
AgsI TTSAA 2 cut(s) 263, 358
AjnI CCWGG 1 cut(s) 86
AluBI AGCT 2 cut(s) 297, 319
AluI AGCT 2 cut(s) 297, 319
Aor51HI AGCGCT 1 cut(s) 32
AoxI GGCC 2 cut(s) 23, 243
AspLEI GCGC 1 cut(s) 33
AspS9I GGNCC 1 cut(s) 244
AsuHPI GGTGA 1 cut(s) 203
BbvCI CCTCAGC 1 cut(s) 92
BciT130I CCWGG 1 cut(s) 88
BfaI CTAG 2 cut(s) 57, 177
BfoI RGCGCY 1 cut(s) 34
BglII AGATCT 1 cut(s) 109
Bme1390I CCNGG 1 cut(s) 88
BmgT120I GGNCC 1 cut(s) 244
BmiI GGNNCC 1 cut(s) 246
BmrFI CCNGG 1 cut(s) 88
BpmI CTGGAG 2 cut(s) 70, 335
Bpu10I CCTNAGC 2 cut(s) 27, 92
Bsc4I CCNNNNNNNGG 1 cut(s) 93
Bse3DI GCAATG 1 cut(s) 130
BseBI CCWGG 1 cut(s) 88
BseLI CCNNNNNNNGG 1 cut(s) 93
BseMI GCAATG 1 cut(s) 130
BseMII CTCAG 3 cut(s) 83, 174, 288
BshFI GGCC 2 cut(s) 25, 245
BslI CCNNNNNNNGG 1 cut(s) 93
BsnI GGCC 2 cut(s) 25, 245
Bsp143I GATC 2 cut(s) 109, 136
BspACI CCGC 1 cut(s) 48
BspANI GGCC 2 cut(s) 25, 245
BspCNI CTCAG 3 cut(s) 84, 173, 287
BspLI GGNNCC 1 cut(s) 246
BsrDI GCAATG 1 cut(s) 130
BssMI GATC 2 cut(s) 109, 136
Bst2UI CCWGG 1 cut(s) 88
BstC8I GCNNGC 1 cut(s) 121
BstDEI CTNAG 4 cut(s) 27, 92, 160, 274
BstEII GGTNACC 1 cut(s) 191
BstH2I RGCGCY 1 cut(s) 34
BstHHI GCGC 1 cut(s) 33
BstKTI GATC 2 cut(s) 112, 139
BstMBI GATC 2 cut(s) 109, 136
BstNI CCWGG 1 cut(s) 88
BstPI GGTNACC 1 cut(s) 191
BstSCI CCNGG 1 cut(s) 86
BstX2I RGATCY 1 cut(s) 109
BstYI RGATCY 1 cut(s) 109
BsuRI GGCC 2 cut(s) 25, 245
Cac8I GCNNGC 1 cut(s) 121
CfoI GCGC 1 cut(s) 33
Cfr13I GGNCC 1 cut(s) 244
CviAII CATG 1 cut(s) 241
CviJI RGCY 6 cut(s) 25, 64, 91, 245, 297, 319
CviKI_1 RGCY 6 cut(s) 25, 64, 91, 245, 297, 319
DdeI CTNAG 4 cut(s) 27, 92, 160, 274
DpnI GATC 2 cut(s) 111, 138
DpnII GATC 2 cut(s) 109, 136
Eco47III AGCGCT 1 cut(s) 32
Eco57I CTGAAG 1 cut(s) 222
Eco91I GGTNACC 1 cut(s) 191
EcoO65I GGTNACC 1 cut(s) 191
EcoRII CCWGG 1 cut(s) 86
FaeI CATG 1 cut(s) 244
FaiI YATR 6 cut(s) 39, 101, 232, 234, 242, 255
FatI CATG 1 cut(s) 240
FauNDI CATATG 1 cut(s) 232
FspBI CTAG 2 cut(s) 57, 177
GlaI GCGC 1 cut(s) 32
GsuI CTGGAG 2 cut(s) 70, 335
HaeII RGCGCY 1 cut(s) 34
HaeIII GGCC 2 cut(s) 25, 245
HhaI GCGC 1 cut(s) 33
Hin1II CATG 1 cut(s) 244
Hin6I GCGC 1 cut(s) 31
HinP1I GCGC 1 cut(s) 31
HinfI GANTC 2 cut(s) 83, 370
HphI GGTGA 1 cut(s) 203
Hpy188I TCNGA 2 cut(s) 163, 286
Hpy188III TCNNGA 2 cut(s) 80, 140
HpyAV CCTTC 2 cut(s) 197, 257
HpyF3I CTNAG 4 cut(s) 27, 92, 160, 274
Hsp92II CATG 1 cut(s) 244
HspAI GCGC 1 cut(s) 31
Kzo9I GATC 2 cut(s) 109, 136
LmnI GCTCC 1 cut(s) 316
LpnPI CCDG 6 cut(s) 65, 73, 100, 261, 299, 380
MaeI CTAG 2 cut(s) 57, 177
MaeIII GTNAC 2 cut(s) 191, 236
MalI GATC 2 cut(s) 111, 138
MboI GATC 2 cut(s) 109, 136
MboII GAAGA 2 cut(s) 18, 65
MflI RGATCY 1 cut(s) 109
MluCI AATT 2 cut(s) 11, 51
MlyI GAGTC 1 cut(s) 77
MmeI TCCRAC 1 cut(s) 205
MnlI CCTC 1 cut(s) 87
MseI TTAA 1 cut(s) 392
MspR9I CCNGG 1 cut(s) 88
MvaI CCWGG 1 cut(s) 88
NdeI CATATG 1 cut(s) 232
NdeII GATC 2 cut(s) 109, 136
NlaIII CATG 1 cut(s) 244
NlaIV GGNNCC 1 cut(s) 246
NmuCI GTSAC 1 cut(s) 191
PfeI GAWTC 1 cut(s) 370
PleI GAGTC 1 cut(s) 77
PpsI GAGTC 1 cut(s) 77
Psp6I CCWGG 1 cut(s) 86
PspEI GGTNACC 1 cut(s) 191
PspGI CCWGG 1 cut(s) 86
PspN4I GGNNCC 1 cut(s) 246
PspPI GGNCC 1 cut(s) 244
PsuI RGATCY 1 cut(s) 109
SaqAI TTAA 1 cut(s) 392
Sau3AI GATC 2 cut(s) 109, 136
Sau96I GGNCC 1 cut(s) 244
SchI GAGTC 1 cut(s) 77
ScrFI CCNGG 1 cut(s) 88
SetI ASST 3 cut(s) 299, 321, 369
Sse9I AATT 2 cut(s) 11, 51
SsiI CCGC 1 cut(s) 48
SspMI CTAG 2 cut(s) 57, 177
StyD4I CCNGG 1 cut(s) 86
TasI AATT 2 cut(s) 11, 51
TfiI GAWTC 1 cut(s) 370
Tru1I TTAA 1 cut(s) 392
Tru9I TTAA 1 cut(s) 392
TseFI GTSAC 1 cut(s) 191
Tsp45I GTSAC 1 cut(s) 191
TspDTI ATGAA 2 cut(s) 65, 161
XspI CTAG 2 cut(s) 57, 177
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.